Description :
From Genome Similarity Track
Location :
Scaffold_66:108273- 109808
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17351tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA

Sequence
1535 bases(100 bases per row)
CGATGTAGTCGTGGTAGGCGGTGGCCACGCCGGCTGCGAGGCAGCTGCTGCCGCCTCTAGAACGGGTATGCCACTTTAACATTCAGGGCAATGACGTGCT
AACAATTTCTAACCGTATTCTATTCAATGCAATCCAGGTGCTAAAACCGCATTGGTCACACAAAAGTTGGCAACAATTGGCGAAATGTCGTGCAATGTAC
GTGGCAATTGGTTAAATTAATCTGCTTGCTTCCAACTCACTGACCTACATGCAAAATTTCGTTATGGCAGCCGTCCATTGGTGGTGTGGGCAAAGGCACT
TTAGTGCGTGAAGTGGACGCAATGGGTGGCCTCATGGGTCAAGTGGCCGACTCTGCCGGTATCCAGTTCCGTATGCTTAATTCGGCCAAGGGACCAGCGG
TGAGAGGCCCGCGAGCTCAGATGGATCGAGATTTGTACCAGCAAGGCATGCAGAAGGCACTTCAGGAGTTACCGAACCTCTGGCTGGTAGAAGATGGAGT
GGATGATCTCATGCTGGAGAAATTGAGTCAAAGCGAGGGAGACGTGGAGGAGCGTGTGAAGGGCGTGGTGACTTCTTCCGGTCGGGAGATCGAGGCATCT
CAGGTGGTTATTACGACGGGAACATTCATCCGCGGTATGATTTACCAGGGCCCCGATATTCGCATCCCGGCTGGACGACACATGCGCGATACTGACGGAC
TCGAGCCCCCGGCAGTTGGACTGGCGCAGACATTGGAGCGCTGCAAATTCCCACTTGGTCGACTGAAAACCGGCACTCCACCGCGTCTTGACGCACGCAC
GATTGACTATTCAGGTCTCGAAATTCAGCCAAGTGACAACCCGCCAAAGCCGTTTTCGTTCCTAAACGAGCATAAGCAGGTGCCGCTGGCGGACAAGCAG
GTGGTTTGCCACGCTACCTACACCAACGAGGAAAGCCATCGCATTGTACGCGAGAATTTGCACATGTTGCCACAATATGACGGTGGACGGGATGGCGAGG
GCGTGGGTCCACGTTACTGCCCTTCGATCGATGCTAAGGTCGTTCGATTCGCTGATCGTTCGAGACATCAGCTGTGGCTTGAGCCTGAGGGTTTGAATAC
GCACCTGGTGTACCCGAACGGCATCAGTACTGCACTGCCTGAAAATCTACAGCTCGAGTTGTTGCGTACTATCAAGGGACTGGAAAAAGTGGAGATTGTG
CGTGCAGGATACTCTGTTGAGTATGACTACGTGGACCCAAGATCGCTGCATCCTACACTCGAAACGAAGAAGCTGTCTGGACTGTACTTGGCTGGTCAGA
TCAATGGCACTACGGGGTATGAAGAAGCAGCAGCACAGGGTATCGTGGCTGGTATGAACGCTGGATTGAGTGCTATGGGAAGGGAACCACTGATCCTCGA
CCGCGCCGACGCCTTCACCGGTGTACTGATCGATGATCTCATCTCTCTAGGCACCACAGAGCCGTACCGAATGTTCACTTCTCGATCGGAATTCCGGCTG
CTGCTTCGCGCAGATAATGCCGACCTGCGATTGAC