Description :
From Genome Similarity Track
Location :
Scaffold_1063:10825- 13278
Transcript NameFunction/comments
Phyta_totarag11907hypothetical protein

Sequence
2453 bases(100 bases per row)
GACATGCAGTGAGTGCAGACTTATACGGGACCATCTCACGATAATTTGAAATCAACCCGAGGAATCTACGTAGctccttcttgctgcaggGTTCGGCAAT
TGTGCTGGATGGCCTCGACTTTCTTTGCCTGGGGCTGAATGCTCTTCAGGGTTAGCGCCTCGCAAAATAACCCATGTTCGCGTCGAGGGTGCTCATGCAC
TTGGCTTTTCCCAGACGCAACAAAATTTCTCGAATTTTCAGCACGAAATAGGGAGACCGTCGAAAATAGTTGTTCAGTCGACGGAAAGCCACAAGTTGAA
GGAAAGCACCGCTGAGCTTCTGCGGGAAGaaggctggagctgccgactCATAGTCGTATATCTGCTCGAGCacgtcaagctcaaggaggtgctggatctc
GCGTCGTacggcgtcttcttggccgcgtAGGACGGTGTATAGTTTCGCGTGCGAAGGCACGTAGGCGTTGCTCAGGGGCTAGATGTAGTCGTCCAATCGG
GTTATGCCAAGTCGTTCGCTATACAAAACGTAGTGTTCTTCGAGGCCTCTCAGGTAGCAATGCTTCAGTGCTGCATCCAGATGCTCCGGCAGTATATTGG
CGGGTTTAACGTCGGATTGTTCACCCACGGGCAACTCTTATACGTCTTCCTCGGCAACTTCTGCCAAGCCACAATACGTACCCCAAAGTCCACTACCAGG
CCAAGTGCCGCCATCAGGCCACGTCCAATCACCATTTCGTCGCGTAGCGCCGGCAGAATTTTGAAGTGATGGATGATAATCCCGGAATCCGTAAACACAC
CGCCATAGATCCGTCGCTGGTCATGTTGCCTTTGGCCAGGTCgaacgagacgctggagcctTCCAGCTTGGCACCTTGAGCTTTGCCTGCGTGCACCGTT
TCGGATGATGCTTCGGGAGCTGCCGCTGTCGAGAAGCGCGTGGTAGTGTTCTATGCCatgctccagcttcatcaTGATTTTTatcggagctggcgcagca
aTTGGCTTCGTGTTGAGGTCCATGAATATGTACTCCTCTTCGCTGGAGCTTTGGCTCATCGGTTGCGCTGCTCTACACGAGTTTGCCCTTGGCGGCGTCC
ACCTGCGCCACGTCTGCCTGAGCGTTGAGCAGCGTTACAGTCACGCTAGTGACCGGCCTGAtgatgttcttcttgacgattGTCGCTGCGAAGTTTGCGG
TAGTCCTCGTGTTATACGTCGTGATCCTGTGGAAGGTACAGTACTTGTTGCTTATTGAGTCGTTACCactgccgttgccgttgccgttgccgttgccgtt
gccgttgccgttgccgttgccgttgcctCGGCCACGGTTACCACCGCTGTTCTGCTGACGATTGTTATTGTTGTGTAGTGGTTGTCATTGTTGCTGGGTT
GCATGAGGAGTTGATTCGACGACCGTGGTTGCGTGCGTTGTCGTGGCTGTTGTTTCGTTTGTCCTGGCCACCAGAACGAtgcaggcgctgcttgaagaaC
GGTATGAGTGTTGCAACCGTGATTTACGTTTGGCCGATGGAGTCATATTGGTTTTGCCATACGAATGGTTCAAAGCAACCTCGCACATCGGCGAGTTCTC
GCTCAGTCTGTCGAGCGTGTGCTCCACGCGCACCAAGGCACAGAAACACTTGCTGTATCCGTGTCTGACATATGGTGAGACACTACATAAATCCAGCCAT
CTGGTCAATATAAAAATCAAGATGTATCTCAAACGTGGATACGTTTCCGCGCGCAATTGTGACCTTGTTGCACGTCGGATTCAGCCACAAGATCACGTCC
GCCGTGAGTAGTGATTCCGCTGAGTTCGCCCCAGTTTTCAGATCGCAAATCGCCCTAAAAACAGTGATCTGTGACCAATCTTCCATGGGCGAAAATGGAC
CTCCATGGGGCAGGCTGTGGCCGCCGTGCTGCATGGCATGCTCGTCCACAAAGATGCCAAGACTTCCTTGAGTCAGCAAGGAGGCATTGCGACGTCGAGG
CCACGGCATTCCAACATGCACGCGAGTTAGGAGAGGAGGTCGGCGTGTTTGGTGCGAGTGCATGAGCAAGGAATATAATCGATGTGGATGGTTTGcatcg
aagaagacgaactgCGCTACATTATCCACGCTTGTAGCGCCACCAAACGGACGGAAGAGCAATAGTTAAGACAGATCACAAGGCCTCTGCACAATGACTC
CTTGATGGAGCGAGGGAGGCTCTGCAAGCAACCTGGCGTCGTCCGGCGAGACGTCGGAGCAAGGCTTGCCAAAAGCCCACCGAGCCGCAGCGCAAGAGGC
GCGCTCTTCAACACATCACGCCTGGTCAAATCCCAATACAAAAATACAAGTTAGTGCGAGTGGGTCTCGTTTTGTTGATCAGGGTAACGTTCGAAATCAG
GTCCACATACATTTCCCAAGCTTAAATAAAAAGTGGCTTCTCCTGCGTAGGCC