Description :
From Genome Similarity Track
Location :
Scaffold_481:10825- 12314
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_481-snap-gene-0.10Nucleolar protein Nop56

Sequence
1489 bases(100 bases per row)
CACTCACAGCCACGCCGTTTCGCGTCAACATGTGGTCCCAAGCACCCAAATACCCAAACCAGGTTCGTATCAGCATGCAAGCAAATTCCTAACATTCCCT
CCATTAACAGATCGCGTCGCCTAAGTATCGACATGGCAAGGGATTGGAGCTCTTCACCAGTCATCGCGCGTGCGCCAGTCCTTTTCAGTGGCTTTGGCGT
AAAACCCCACTAAAACCTCACGCGCCGCGCCAGCCGAGCCGCGCGCCTTGACGGTTGGTGCTCCAAAATTGAAACGAGCAGTCCTGCGAAAATGGTGCGT
CCGTGGCTTCTGGCTCGCGCCTGCCGATGCCTTCTGGTGCTGCAGCTGAGCATGCAGCATCTTGGCTGTCTTGTGTGTGTGCGCTGGTGTTTAATGCAAT
TGTCTGTCTGTCTCTGCCTCTGTGTGTGCTGCGTCTTGACGGTGCGCGATGCAGGGTGTGAACCAGTTTGTGCTTTTCGAGTCGGCCTCGGGCTACGCGC
TCTTTGAAGTCGTGGAACATGAGGAGATCGGTACGCTCCTCGCCGAAGTGCAGGAGAGCGTGAACGACCTGGCCAAGTTCGGCCGCATCGTGAAGCTGAA
GGCGTTCCAGCCGTTCACGTCCGCGGAGAACGCGCTCGAGAACATCAACAACATCTCGGAAGGCATCCTCGGCGAGGACCTCAAGAACTTCTTGGAGATG
AACTTGCCAAAGGTCAAAGCCGGCAAGAAGGCCAAGTTCACGCTCGGCATCCAGGACAAGAACCTGTCGCAGGCCATCTCGGACGAGCTCAAGGCGCCAT
GCAACTCGAACGAGACCACGGTCGAGATCCTCCGTGGTGTGCGTTTCCACTTCAGCAAGTTCGTGAAGGAGCTCGACAACGGCAACTTGGGCAAGGCGCA
GCTCGGTCTCGGCCACAGTTACTCGCGCGCCAAGGTTAAATTCAACGTCAACCGCGCGGACAACATGATCATTCAATCGATCGCGCTCCTGGACCAGATG
GACAAGGACATCAACACGTTCGCCATGCGCGTTCGTGAGTGGTACTCGTGGCACTTTCCAGAGCTTGTCAAGATTGTGAACGACAACTACGTGTACGCTC
GTTGCGCGTCGTTCATCAAGAACCGCAACACGCTCTCGGAGGACAAGCTTGACGGGCTCAAGTCGATTGTGCTCGACGAGGAGAAGGCGCAGCAGATCCT
ACACGCGTCGCGCTCGTCCATGGGCATGGACATGTCGGAGATCGACATGATCAACGTCGACAACTTCACCACGCGTCTCATCAAGCTCGCCGAGTACCGT
CGCCAGCTCCACGAGTACCTGGTGTCGAAGATGTCGACCGTGGCGCCGAACCTTGCGTCGCTCATCGGTGAGACCGTTGGTGCGCGTTTGATCTCGCACG
CCGGTTCGCTGACCAACCTGGCCAAGTGCCCAGCGTCGACCGTGCAGATCCTTGGTGCCGAGAAGGCGCTCTTCCGCGCGCTCAAGACC