Description :
From Genome Similarity Track
Location :
Scaffold_513:10825- 12263
Transcript NameFunction/comments
Phyag_g6297conserved hypothetical protein

Sequence
1438 bases(100 bases per row)
GAACATTAGACCTGGGGGGCCTCCACCATGCAAAAGCCCTCGCTGCACTCACTGCTCTtggactgcagctccagtgaGACGCCATTGTCAACCACTCGTT
CGGGCGAGACCGCGACGACATGACGTCGGGCAATGCGCGTTTCGCGGATGAACTCGCACAGCGAAATCTGGGCCAGGTCGTCAGCCGAgaatttcttctt
cggggACTTGAGCACCATGATCTTCGTGTTCAATCGGCGGCTCGCTTCAGCTGAATAAGTCGCACACACACGGTTAGCTTGCAACTATCAGGCAAACCAA
GAGGAAAGAAACCAACGCACTTCGTGATCGCACGCCGTAAAATTGGCAGACGCTGTGGATGATCAGTCGATGGAAGGCCGAATCCAGCAGAGGCAATATC
AACCGGACGTCCTTCTCACTCGCTTTCATCAACTCAATCGGGTGTTTTAGCATGCGGAACAGCGGTGTTGCTACCTCCAACTCGGACGGAACCTCTCGCC
ACTAACGTTACAGCAACAATTAACAATGAAGATCCACTCTGGATATCATGCATCAGCATATACATCCATACCTGGATGAAGTGCAAGACCACGTATTCCA
CAGCTTCAATGAACGGCGCGAACGAGTTGAAAGACCGCAGCATCAGCGTCCGTGCACGACGATCAACACGTGAAAACATTTGCTCGGCATCTGCCACAGT
CACCAACatcagcaacttgcagtCCCTTCCAATACCACAAAGAATAAGTGTCAGCTCACCGTTCCATTCGTCTTTGCGTCGATTGCGTGGTGCATGCGAT
CGGTTGTCGTCATGTGCACCTCCTCCCTTACGGAACGCCGTCTGGAGTTCTTCATTCTGGGGTTCGGCCAACTTCTGAAAGTTCGACCTGATACCCATCA
ACCCATGGTAAATTCCCCAACCCATTCAAAAAGACCAACTAATCAAATGCTGTAGCCCACCTCCACTCCACATTGATGTCCATGTGCTCCATCAAATCCT
CCAGTCTTGTAGACGCCGCTCGGTTGCCAAAATGATGGTCTGCCACAGCACAATCACTCCTCATCAGTCCCAACCCATCTCCAAAGCCCTCCCGTATCTA
ATATCCTCACCGTTAAACcagcgttgctgcttgcgcacACCCAGCGGCAGCTCATTGGGCTTGGACAGATACCCGGCTGATCGAATAGGGTGGATGTTGA
TCAGCCTCTTACTGCGTGCAAGCGGCGAGTCGCTGGCCCGTTTCTGCGGCGTACGTGCGCGTCCGGACccgttgccgttgctgccagAGCGCTCCACACC
CGCGATTGTgctcttgttggcgttggcgacgtCGTCTGCAGCCGTCTCGGTGCGGAGAGGAGCGATGGGGCCTTCTCCCCAagccatctccagctccaac
tcACTGCCGCACAGCGAACTCACGTCCGAGTCGCTTAC