Description :
From Genome Similarity Track
Location :
Scaffold_604:10825- 11848
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_604-snap-gene-0.8EF hand family protein

Sequence
1023 bases(100 bases per row)
AGAACGCTACGTCCCGAGGGCCCACAGGTCAGCGTACGAGTGCTTCATTCTGCGATATTCTGGACTACAGCAGCTCAACAGCAAAGTCGGCGCCATCGCG
TCGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGACTCGCTCGCTGCGTGTCTGACCATGGCATCTACGAGC
AAGCCGCCATCAGCAACAGCAGCAGCAGTGCCTGGAACCACAAAAGTCGCAGTCGTAGCGCAAGATACGCCGCAGCGTGACCACCCCGTCGGCGTGCAGC
TCATCATTGCAAAGCTGAAAAACGGCCTCAAGGCAAAAGGCGCGCACGGATTCTGCGGTCTCAGCCGCAAGTTTCGACTCATGGACGATGACGGCAACGG
GTCGCTGAATGTGACCGAGTTCCGCAAGGCCATGAAGGACATGGAGCTCCAGGATCTCACGGACGCCGACTTGAGACTGCTCTTCCAGTACTTTGACCGC
GACCGCAGCGGCAGCATTGATTTGAACGAGTTCCTCGTCGGTGTGCGCGATCCGCTGAACGAGCGCCGCGTGTTGTTTGTGCGAGAGGCGTTCAAGCGCA
TGGACAAGGACGGCAACGGTCTTCTCGAGCCAAGCGACATCGTCGAGGCGTACGATGCCAGCAAGCACCCAGATGTGCTCTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAACGGCAAAATCACATGGACACAGTGGCTCCAC
TACTACGAGAACATCAGCGCGAGCATCGACGACGACGACTACTTCGAGCTCATGATGCGCAACGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCA
ACCGCCGAGTGCTCGTGACACTGGCTGACGGCACCGACATCGTCAAGGAAGTGCAAAACGATCTTGGCGTGCCGATCCAGGATGTCCAGTCGAGACTGCG
CACTCAGGACGATCGCGTAGATG