Description :
From Genome Similarity Track
Location :
Scaffold_604:10823- 11860
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_604-snap-gene-0.8EF hand family protein

Sequence
1037 bases(100 bases per row)
CCAGAACGCTACGTCCCGAGGGCCCACAGGTCAGCGTACGAGTGCTTCATTCTGCGATATTCTGGACTACAGCAGCTCAACAGCAAAGTCGGCGCCATCG
CGTCGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGACTCGCTCGCTGCGTGTCTGACCATGGCATCTACGA
GCAAGCCGCCATCAGCAACAGCAGCAGCAGTGCCTGGAACCACAAAAGTCGCAGTCGTAGCGCAAGATACGCCGCAGCGTGACCACCCCGTCGGCGTGCA
GCTCATCATTGCAAAGCTGAAAAACGGCCTCAAGGCAAAAGGCGCGCACGGATTCTGCGGTCTCAGCCGCAAGTTTCGACTCATGGACGATGACGGCAAC
GGGTCGCTGAATGTGACCGAGTTCCGCAAGGCCATGAAGGACATGGAGCTCCAGGATCTCACGGACGCCGACTTGAGACTGCTCTTCCAGTACTTTGACC
GCGACCGCAGCGGCAGCATTGATTTGAACGAGTTCCTCGTCGGTGTGCGCGATCCGCTGAACGAGCGCCGCGTGTTGTTTGTGCGAGAGGCGTTCAAGCG
CATGGACAAGGACGGCAACGGTCTTCTCGAGCCAAGCGACATCGTCGAGGCGTACGATGCCAGCAAGCACCCAGATGTGCTCTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAACGGCAAAATCACATGGACACAGTGGCTCC
ACTACTACGAGAACATCAGCGCGAGCATCGACGACGACGACTACTTCGAGCTCATGATGCGCAACGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAC
CAACCGCCGAGTGCTCGTGACACTGGCTGACGGCACCGACATCGTCAAGGAAGTGCAAAACGATCTTGGCGTGCCGATCCAGGATGTCCAGTCGAGACTG
CGCACTCAGGACGATCGCGTAGATGCCAAAAGCATCG