Description :
From Genome Similarity Track
Location :
Scaffold_672:10821- 12498
Transcript NameFunction/comments
Phyta_totarag10080hypothetical protein PHYSODRAFT_515318

Sequence
1677 bases(100 bases per row)
AGCGTTGCTTGTGGCGGCCAAAGCGTACGACGAGCACGATAGTGCCGGCGAGCTGTAGAAATGCTGCATATCCTACGAGGATGAACATATTTCTCGTCAC
GTTGGCGTTCCCCATGCCGTAGCTTCGAAGCAGTGTCCAAGCCTCTTCGGTGTTAATCTGAGAGAAGTGTTCGTACATGAAGGACTCGAACGAGTACGTG
TGGAAGGCCATGTAGTAGCCCCATTTCCAGTACGCGGGGATGGCAGGGAACGGAACCATGAAACCCTCGCAAAGCATGAACATGCCGAAGAGTCCAGCAC
CCAGAGCAATGCCCATGATGTAGTGCGGCACGGCAGCACCGAGTAGATGCATCATTGACTCGGCGGTGACAAGCGACAGCGTCAAGTTCAATAGAAAAGA
TCCAAATGAATGCACGTGGGCGAAGTACACGACGATGATTGACGCCAACAACGAGATGAACATGATGCCAGGCAGGGCACCGAGAAGATTGGCAGTTGTG
TAGCTTGCCAGATGCAGCGAATGCGAACGCACCTCTCGCTCCAACACGGCCCGTTGCTCCAGAAGTGCAGGGAGGGCTGCAACTGACATGAATACCAGGA
AGGCTTGCACGTAGAAGAGCAGCGGGACCATGGCGGAGCTCGTAATATCTCGATTCGAGCTCAGGTACATTGTGCCAACCATGAACGAGAGCAACATGTA
CATGAGTACACGCAGCCAAAACACTCCCGGATGGCGCCAGTTGTTGGATAGGTTCCGATGCAAGAGAACGCCGAACTGATCGAGTCTCGACGGGCGCATA
GCTCGCAGCATCTCGTAGTTGATGAGGTTCACGTCTCGCATTGAGCGATCGCGTGCTATCTCGACACGTAAACGCTGCGGTTCGGGGCCCTCTTCCAGTG
CTCGCACGAAGTGGCCAAGGCCCAAACCTGGGTGGAAATCTTTGTTCACTAGATGAACAAAGTATTCGGCTGGATTGGAGTACGTTGGGCACACGTAGCC
CAGCGAGCAGAAGTGCGTGAgggctgtggctgctgggcCAAAGTACACGAGCTCGCCGTCGCTCAAGATGATCAGGTTCGTCAGCATTTCGAAAACGGAA
GACGAGGGCTGGTGAATCGTGCAAATGACGTTCTTGCCGCTCTCCTGGCAGAGCCGTTCAATGTGCTGCATGACACTACGAGCCGAGGAAGCATCAAGTC
CGGAAGTTGGTTCGTCAAGTAGCAGCAAAGCTGGATCCGAGAGCAATTCCACAGCGATGCCGAGTCTTTTTCGCTGTCCTGATGATATACCTTTATGGAA
AATATCCCCCACATTGGCATGCATGCAAGTCCGCAGCCCCATGGCGTCAATAACGTCTTGAACACGGGACTCACGTGTGAGGATAGGCACATGACTTGGC
AGTCCAAGGCCTGCCGCAATCTGCAAGGTCTCCAGAACCGAAAAGGATCCGAGGAACGCCATGTCTTGCGATACGTAGTTCATAATGAAGTGGAATGTGC
GCGGATCTCGAGGTTGGCCATTGACATCAATAATTCCCTCGACACGCACTCCGGGCCCCCCTAGCGGCACACGATCAGCTAAAATGTCCAGCAGTGTAGT
CTTGCCCGCCCCGGAAGGCCCCATGATAGCTGTGAGGTCTCCAGGACCTGATCGACCCCATACACTGTTTAGAATTT