Description :
From Genome Similarity Track
Location :
Scaffold_1324:1082- 2234
Sequence
1152 bases(100 bases per row)
GTACCGCATAAGACGTCCAACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGCAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAT
TGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTGACAGTGTCAAGAGGTGGGTTCCTCGTGTCTAGCAACACTAAGTCCCTCACCTTAA
ATATACTTAAGCTTCCTCTTCCATGTTTGTCTAAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAACGCTCAGCTT
GGTATCCATAAAGGATTACACCTGTTTCCGCAGCGAAACTGGTCTCACATCCGAGACCTAGGAGGAAAGGGCCTTCCGAGCCTCTTCCCCACTTAGAATA
GAGGAGTCAGTGTCTCCTCGAGGAGTGAGAGGCACTCTGGGGTGACGGAAGCCGTTCAAGTAGAACGGCGCGAACCCCGTGGACGCGTGCACCGCGTTGT
TAAGCGCAAACTCAACAACTGGAAGCTGCAACGACCACGTACGTGGCGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTC
TGTTTGGCCGTCTGTCTGCGGATGATCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGG
TCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACATCCTTGCGGTTTGTTCGCCCGTTACAGTGACGTAAACTG
GAGCAAGATGTATTATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCAT
CGACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTGACGTAT
CGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCATGCG
CCTCCGCGAGGATGTCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCG