Description :
From Genome Similarity Track
Location :
Scaffold_23:1081816- 1083109
Sequence
1293 bases(100 bases per row)
GCCGTGGCGAGAAACACAATCATGCGAATGGTGGAAAGTACCGCGGTCGTGAACAAGGCAACAATCGTCCGTTTCAATCCAACAATGACGACGATGGCGA
CAATGACTGCGAGAACAGTCGCAAGGTGCTTCATCAAGGCCGTCGCGATGTTAGTTTGATCGCAGTTGCGACGTCGACCAACCCACCAGTGAGCCTCGCA
GCCAAAGCCAATGACCCACCAGTGAGGTTTGCGGCCAAAGCCAATATTAAACTGGACCCTACCTGGACCATCGACTCTGGATGTACGCGCCACGTGACAC
ACGAATCCCAGTGGTTCAGTAGCATCTCCACAAGTGGTGGATTGATCACTGTGGAAGGCAACAACCAGATCCCAATAGAAGGCTTTGGACGAGCTGAACT
GGAAGTCACAGACGCTAAAGACAACTCGAAGACGCTCACCCTTCAAGGAGTTCAGTACGCGCCTCTACTGCAGTTCAACCTGCTGCCAGTCCCGGCTGCC
GTGAAGCAAGACTACCGCTTCAGCTTTGATCGCAATAAGTGTGCTGTACAGACAGACTAGCGCTTCAAGATCAAGGCGGCAATGGCGACCAACACTGATT
TGTATCGGTTTCAGGCTCAACCAGTGGTGACCGCAAAGGAACTTGTGGCCTCGGGTAAGCAACGATCTTATCTGCTTTTGCACAAACGTCTTGGTCATCC
TAACGCTCGCATTCTGCACGAACTATCAAGAAGCCAAGCCATTGCTAGTCTCGATGACTCTGCAGCTGCTGGTCCGTTCAGCTCAGTTCCTCTGTACTGT
ATACACGTTAGCGAAGTCACACCGCGCATCATTCTATTCTAATAGAGTAATTGAACGTGCCACATCTCCCTTGGGAAAAGTGCATTCAGATATCTGTGGT
CCATTTCCTGGGACTAGCCTTACTGGGTGCCGATACTTTGTGATCTTTATCGATGACTTCTCCCGATTCATGTTCACCTACCCTATAAAGCACCGTAGCG
AGCTATACGAATGCTATGATACCTTCAGGAGGAAAGCCCTAAACATCTACCGACGCGACGGCAATGTACTTCAGCATACTCACAGCATTGAAGACCACGA
TATTCAACGGTTTCAAGCGGATAATGCGCAGGAATACGAGAAACTTGGCCGCACAATCTTTCAGAAGTATGGTACCCACGCCCAGCTTACGAACGCGTAC
ATACCTCAGCAAAATGGTGTTGCTGAATGACGCATGCGAACTATCATGGAATGGGTACGGGCACTACTGCTGGACGGAAAACTCCTAAAGCAA