Description :
From Genome Similarity Track
Location :
Scaffold_131:108173- 109747
Transcript NameFunction/comments
g3043.t1hypothetical protein

Sequence
1574 bases(100 bases per row)
GACTACTTTCGAAATGTGTCTGAAGGAGAAGACAGCGCTATGCAAGTTTGCGTGGAGATTCCTCATTATTGATGAGGCGCATCGCATCAAGAACGAGAGC
TCCCAATTCTCTACGGTCGTCCGTATGCTTGACACGGAGCACCGACTGCTGCTAACGGGCACACCTCTTCAGAACAACCTGCACGAGCTGTGGGCATTGC
TCAACTTCCTGCTGCCCGATGTGTTCGCATCGTCTCAGGAGTTTGACGATTGGTTCAATCTTGATGTGGATGATGATGAAGCGAAGAAGCAGATGATTAG
CCAACTGCACAAGATTCTGCGACCATTCATGCTTCGTCGTCTTAAGGCGGATGTAGAGAAGAGCCTTCCGCCGAAGAAGGAAACGCTGCTGTTTGTGGGC
ATGTCCGAAATGCAAAAGGCACTGTACAAGTCGCTGTTGCTCCGCGATATGAACACAATTATGGGCGGCTCAGGTGGTGTGTCCAAGAGTGCGCTACAGA
ACATTGTGATGCAGTTACGAAAGTGCTGCGGCCACCCGTATCTTTTCGAAGGCCAGGAGGACCGGTCTCTAGATCCTTTGGGAGAGCACGTGGTGGAAAA
CTGTGGTAAAATGGTGCTGATGGACAAGCTGCTGAAGAAGCTCAAGCAGCGTGGTTCTCGTGTGCTCATTTTTACGCAGATGACGCGAGTCTTGGATATT
ATGGAGGATTTCTGCCGCATGCGCCAGTATAGCTACTGCCGTATCGATGGTCAGACTTCGTATGAAGATCGCGAAAGCTCTATCGATGAGTACAACAGAC
CAAACTCGTCCAAGTTCCTGTTTCTGCTGTCCACCCGCGCTGGTGGCCTAGGTATTAACCTGTACACGGCAGACGTTGTGATTCTGTACGATTCGGACTG
GAACCCGCAAGCCGACTTGCAAGCTCAAGATCGTGCGCATCGTATCGGTCAGAAGAAGGAGGTGAATGTGTACCGTTTTGTCACGGCGGATTCGGTTGAG
GAAAAAATTATTGAGCGCGCACAGCAAAAGCTGAAACTGGACGCTATGGTTGTGCAGCAAGGTCGCCTGCAAGAGAAACAGGCGAAACTTACCAAGAATG
ATATGCTGGAGATGATTCGCTTTGGTGCTGATCAAGTGTTCCGCACGACGGACTCGACCATCACTGACGAAGATATCGATGCTATTCTCGCGAAGGGTGA
GCAGCGCACGGAAGAAATGAAGCAAAAGATGCAAGTGCACGATAAGGGTGACATGCTCGACTTTAAGCTTGATGGTGGAGGTTGTCAGAACCACGATGGC
ATCGACTACTCCAACGAAAAAGAACGTCAAGAGGAATTGAAGCGTCTTGCTGATGCAGAACTAGCTCGCCAGATGGCGGAAGGTATGGGCAAGCGCGAGC
GGCGTACTGTTCTTCGTCATAGTCACGTATCGTCCGAGGGCAAACACAGGGCAAAGCAAAAGCAGCTACCCAAGGCCTTGCGCTTACCGCGCATGGATGA
ATGGCAGTTTTACAACCGCAAGCGACTCATTGAACTGCACGAGATCGAGTGTGCAAACTATGAGCTAGCCAAGG