Description :
From Genome Similarity Track
Location :
Scaffold_17:108167- 115823
Transcript NameFunction/comments
Albla_Nc14021640conserved hypothetical protein
Albla_Nc14021650conserved hypothetical protein

Sequence
7656 bases(100 bases per row)
TGTGACACCCTGCTGGTTGCGCAATGCCTGGCTCCGAAAGAAACCCATTTACATGCTCACCAGATTATCGACAAAATGGAAAGAAGCACACGGAAACGCA
TATGCGGGGAAGTTTTTGGAGCAGATGAAATTGCTTACAGTTGTCGAGATTGCCAAGTCGACCCGACTTGCGTTATCTGTAATGACTGTTTTTTGCGGAG
GTTTGACGAATCTTCGAGTTGCGCAATTTCTGACTCGTTGCTGAGCTTGTGTTTGTTAGTGATCATACCGGACATACCGTGCACTTCCAGAGAACAGCGG
CCGGTAGCTCATGTGATTGTGGTGATCCTCAGGTTCTTTATATTTCTCACATGCAATCGGTGCTGGTTGCTGAAGGTTTAGTGTAGGCGTGGAAGCGGAA
TGGTTTTTGTTGTAATCATGCTGGTATGGACGCTTTGGACGCAAGCACAGTTGACGGTCGCATTTGGATTGACGCTCTGAAGTTTGATGGAAAGACAGGA
AAGACATTTTCAAAATGGAGTAAACAACTACACTTGTCCGAGACAATGTGCCAAAACGCTTTTGAAGTTATCGACTCGGTGATCGATCATGTTCATCAAA
CTCTGATCGGGATTGAATATGCTTTTGAGTTGGCGGAGGCTTTCGAGCTATTTTCTCGAGGCATACATAACAAGGCCATAGTATCCACTATCGAACACAC
CACTTCAGTATCGCCGACTGGATCGAACGATCACACACAAGAAAGGGAGGATTATCAAGTAAAGCCGACTTTGCATCGCTCGGGTCAAGGCAAAAAAGCT
TTAAAAAATACCGACGGCGGGCAGTTCTACATACGCATTCACAACGATGATGTACACACATACCACAAGGTAAAGTAAACGATATTGACCAATTCAACCA
GACTGTAATACCTTTGTCTACATCGAGTAGGTTGCCAATACGCTGTCGACCACATTTCAACTATCCGAATCGGTGTCCACTCGAGTAGTTGATGCGATCG
ATCGGCACGGTGACGCCATTATTCGACAGAATTTCCACATACTCGAGTGTCCCTATCCTGCAGCGGAATGCGTTTGGGCGACACTCAATGTTTCTGTGGC
ACCAGCTTGGTTAGATCATCAGATAGTGCAGCTCGGTTCCTTGCTAGACTGGCTATACAAGCTCATACGACGATCGGATGGCTATGATGTTTTGGTCACA
CATGCCCTTTGCAAACCCAGAAAAGCATTATTACGAACAATCGATGAGATTTCAACGATGTTTGACACGGACACGACTTTGCCGGATTTGATAAAGGCAG
GTGGTTTTCGTATGCATCAACAAACCCGAAGCGTGTTTGAAAAAATGATTGGAAGAAAGTCGGTGCACTCATGGGCTCACGATATCGAGAAACAGATACG
CTCTCGTTATGATTTCTTTGGTACAAAAAGCTTCCAGGAGTTGGCAAACGGACCGACCATTTGTTCAAAAGAGAAAGTGCAAGAATTAAGATGCAATAAT
CACTTTGTAAGTAGTTTTGTGGAACACTTGGCAGAGACACCAGAGGAGGCACTTCAGACAGATCCTGTCAACGTGAAAAAGATTCGAGATGGTTGTGAGG
CTATCCTACAACATTATTACGTGGATAGACATAAGGAAGCACCATTCTACTCAACTCTGGAGTTGCTGATGCGATACGATGCTGTATTTCGAAAAGGAAC
CTCAGAGAATCTTCATCGAATTCTCCGTGAACTACTGCTATGTTCCTCCATCTTCCGAGACAAGATGTTGAAGAACTATCTCTATGCGTACAAGCCAATG
ACAAAGTTTTATCTGCAAGGTTTGGGTAACAGCAATGAAACGATATTCGACTTTGCGGTTCAGTTTCTGACTGACTCAAAACTTGTGCAAAAGTACACGA
AGGATGCAATACGACAAGAGGATGATCAGTATAAAGAGGAAAAATCGACGATCCTGATACCTCATCGACGTCGCCCTGAGATCATCAAGGTTTTTCTGGA
TGCTCTCCATGCCACTTTGTTGATTGCGGCACAACCAAAAGGTGACACTGGCGAAAATATCGTCATAGCAGGATCATTAGACCCAGATTTGACCGTGATC
AGCAATCAAAAATACAAGGTAAGCTATGTGATCATGCTTTTATACCATATAGACTCTGACGCGTACTTGTCAGCATTGCGTGGACAATTTGGAATATGTG
CTCAATGTCGGAGAAATTTCGAATGAGGTGATTTGTGTCGAAGAGAATCTCAGACTATGGCTGTCGTGCTTGCGAATCTTACAGAACGGAGATGCAGAGC
GACGTCGTGGTCCTTGGGAAACCCACGTTGAGTATGAATCAGATACTTGGTTATCAATGTTCAATCTCGGTATCCGAATGCATTCAATCTTCCCCGTTGC
CTGGAGGTGCTTTGGCGCTACTGCACTTCGCCAATATGAGACAACGCTGCCTCAAATAATCAAAGTGATCACAAGTGTGGTATTATCGACCTGCAAAGAA
CTACATGCGGGAATCAAAGACAAACATATTCTCCCTGTATACACAATAGCGTCAAGACTCGATCCATCGTCCGAAAGTGGCTTTTTGACGCACAGGATTG
ACTACTCTTCGTTCAAGGTGTCAATGCATGTACCACTACATCGTTTGCTTGCATGTGCAATACGTCGCGTCTGTATCTACGACGTCGATTTTTCTCATTC
GCTCGACCAACACGGTCTGCTTGCAGCACTTGGCTTGAATGAATTAACCGTCGATGAATGCGTGGAGCTTGTGGAGGCGCCATTGCGTTGTCTCGTGATG
GCTTCACAAATCCAATCAAACTTGTGGCGACGTAATGGAGACGAGAATATGATGGCACAACTGTACAATTATTCTGCATTACCATATTGTATCCATTATC
GAGACGCAGACGTATTCATGATGCAGCTTGGTGTGCTGATACTTGGAGCAGAAAGTATAATGGCACGTATCATGGATCGTTTTGGAATTGCAGCCTACTT
TGCGCGTGGCGGTAGTGACGAAGCTGTGTCATCATTCGATCCAGAAGAATGCTGTAAAGCGCTCGGGTACCACACATTGACCAGCGACGCCATTGATAGT
CAGCGATATTTACAGCTGGTCGAGGAATTCCTGAGGTTGATCATCACCGTTGGAACAGCTCTTCCGTGCTCCACGGGGACAGAATATGAGCAAAGTTTCC
TCAAACAAGAGATGTTACAGCAACTATGTGCCAAATCATATCCATTTAGTCGGCTCTTTGAGCTGGCAATTCTACCGTCTGGACACGACGATATCTCTAC
TTCGAGATTAGAAGACATTCTGTCACAAATCGCAGACTTTAACCCTCCCTTGGGTCTTGAACCTGGGCGTTATAGCCTCAAGCCAGGACTCTTGGAGGAG
TACAATCCTTATTTTCTTCATTTGAATCGTGAATCACACGAAATGGCTCGTGATCGGTGGACTACGTTCCGAGTGCAACAGCGGCAGGAAACTCACGATT
CGACAAATGCACGACCAGTCTTTCCACCACCACGACCCATTTCATTTCTAGCACCCGTGCAAGACATTCTCACATGTCGAAGTACGATGACAATCATTGG
AACAATTCTGGAGCGGGCTCTTAGTTCGGATTCTGTGAGGACTCAACAAGCTCCAGCCATATTTGGCGTGTCAGATGGAGTACTTACGACCACCTTGCAT
ATACTCGCCTTCAGTATAGACGTCTTGGTCATCAGTCAGCAAAAAGCGGGATCACCTGACATACTTTTTGATCAGCTTTTTACCAGCGCTTATGCATCGA
AAAGCTCTCTGGTTGAGCTATTGGTACTACTTTATTCCAGAGGCACTTCTTTGTTAGATGCCGATCAATTGGAGGTAGTTGAATGGACGTTGAAATTCGT
GTCAGATAATTCATCCCAATGCAAAGTATCGATCCAAGAGATGACCGAAAAGCTGACAATCAACAACATCGCTGGGATTGAAACACACGAACAAGCATGC
ACACCAGCTTCGGAATCCATGCATGATCGAAAAGAAGCCGCCAGAAAGCGAGTTCTCGATGTAATAGCCAAACAACAAGCATCTTTTCAACTCTTGATGT
CTGAGGACGTTGTACGCAGCCAAGAAGACTCGGACAATGAAGATGAGACAATGGATTGTTTGACGCCTCAGTCAGAAAGTGTAGAGCGTAAAATGACTCG
AAAGAGGCAAAATGAAGTCGCTAATGATACTGTCACGGACATGGAGCAACAAACGAAGCGTCATAAAAGCGTCATCAAGCTAAAGTGCATTTTGTGCCAT
GACAGCTCGAAGCAGGCTGAGATGGGTGTTGCCGCGCTAGTGCATCAGTCAACCGTGATGTCAGGTTCATTTCGACCAGATCCGAGTGTAGCTTTACAGG
CGGATGGAGCAAAAGCGAGGGCTAAGATCAAAAAGCTGATTGAGAAGATTGGATTCTGTTCCGGTAGTGAGAGTCTACTGAGTCACAACTTTGGAAGTGA
AGCAGACATGCGGGCTTTCGGATCCCCTCTCGAAGACTGGATTAGTAGAGGCGTTCCGGAAGATGGGTTTGCTCTGGACACAGACCGCTCGATAGAATAC
TTGCCGGCAATTGAGTCTTTGGAAACAGAGACCAACACCGCAAACGGTCGGGTGATGCTGATTGAAGCTGGCATGGATGACTTCGTGATCGAAGGTGCTG
AATCCGGTGAATCAGCTGGTAGTCCCCCAATAGAATTACCTCGCCCTCCCGCTATAAGGCGAGCAGAACGGCAAACAGCGAGAACCAATCGCCAACGCAA
CATGGCAGCTGGAGATGATGGTGTGGACCGGATTGGAACAGTATCGGTACGACGAATAACGGTATCACATTCGCCTACAAAATTGTACCTGCGTCCATGT
GGATTACACATTCGGACTTGCCAACACGCCGTGCATCGATCCTGCTTGGATGGGTACATTCGCTGTTTGCATGAAAAAGCGACTCGAGGAGAAGAGTTCG
ATGGGGTACAAGCAATTGACCCCGATTCGGCTATGATGCAATTCCTCTGCCCATTATGCAAAACAATCTCCAACTTGCTCATTCCAACGTCAGATTTTCA
CACATTTGAGAATAAAGACGTCTCGCGCAACAAAATACAGGACCCAGTTGCATCCCGGAGAAAAATCAACCTCGCATCTGGAAGTGCTCATTGGTATGAC
ATCTTGCAAGAACAAGCTACTTTCACGAATTGGTATCGTGTGGTCTTTGGACGTGATGGGGCCTGTAATGACAACGAACCAAGTCTTGTGGAACACGAAA
AGTGGCGAGATTATTTTGAGCAGACTTTGTGGGAACCGCATGGAAGTCTAGAGAAGGGTGCTCCTTATCTATGGTCTGCCTGCGCATACTCAATTGCCTC
GTTCAGTCGTCTAGTGGAGGAAGAATTTCGGAATGTTACCGGCGGAGAGGAAATATTTGACCCCCTTGTCCATCCTTGTCCGTCTTCCTTAAAGAAGGAG
ATGCATTCGCTGACTCTGACGACCAAATTCTGTCGATGGTCTTTCACGCTTTTGGAACACAGCGAAGACGCTAAAATCATCTGGGAAACCGCAAAGCGAT
GCTCTCCCTTGCATTACGAGACCAAACGTGATCATAACAAATTTACAAAAGTTTTGGGCACAATCGATGCGTGCTTGCGTGGGACAATTTGGGGACTGCT
GGTAGCCGATAACTTTACGGTTGGAGAGTTTGCATCTGAAAAGTATGTGGATTGAGAAACTAACTACTGCTTGATTGTAGGCATTCGTGGTGGCTAGTGT
TTTATCGCTCAAGTTGGAGAAAATCGGCCTCAGCATCCCGCTGTTTGCGGCTGCTGATCTACTTCAACGACTACACCTCGAGTTTTTTTCACATGATGAA
TGCGACGCTAATATCTTTCTGCAAGACAGTTTGAATATAGCATCAAATGAGGCGTCGGATTCAGATGAACGAGCTTCGACGGGGACAACAAGAATGCAGA
CTCGACGAATGAAGTCCCATCCACCAAAAGCACCGAGCAAATCGAAGTTAATTCAAAGCCTGGAAACTACCACGGCGCTTGTTCAAGCAAAACTCGATAG
CATAGACACGAACGAAAATACCGAAGACTTTGTGACAATTCTACAGATGCTATCACGCATAGCTTGCATGTTTCCTGATCAGAAACTGAAAAGTCGAGGC
CTCAGCAATTTTGAATCACGAGTCTCACGGATCATACAATCCAACCAGCTGCTCGTACGTAGAATGAAGCTTTTCTGGAGGTGCTTATTTGTCGAAACAC
AGTGGTCTGAAAGCATGCGGCAACTGGTTACAGTACCCTCAATGAAAGAAATTGCACAGAGCCCAGACGATGTTTTGACTCAGTTATGGAGATGGTGCGT
GGATCGTCGAAGCAACCAGCAGTATTTGAGCGTTGCTAATAAACGCGAAGTCTGCGAACATACGGAGGACTGTGGTGATTCCTACACTGCAAGCATGTTT
ATCTTGCGAGAAAACCTTTTCAAGCCGCAGTTGGTTCACCTCCCCATCCAGTATGACAAACTTTACAGTCAATACATGGGTCAAAAGTGCGAGCGATGCG
ATAAAGTTCCGACAGAAGCTGGATTGTGCCTCGTTTGTGGACAATATCTTTGCTGCGGTGATTCGTGCTGCGAGACCCCATACATGCTTGATGGTCCCCC
TGTTGGTGAGTGCACAAGACACGCGGCTGAATGTGGAGGTGGTGTTGGTATCGTGCTTCTTCTGGATCAATGTCGTGTTGTTATCATTGCAGGTAGCATG
GCAGCGTACTTTCCAAGCCCTTACGTCGATGCTCATGGAGAAGAAGACATTGGTCTACAGCGTGGTCGTCCATTACGTCTGGATATGGCGAGGTATCGGC
ACTTGGACAGCTTATGGGTCAATCATCGTATCTTTTCCGAAGTGTCTCGTCAACGAAACTTGTGTGATCCTCAGTATGCAATCAACCTCTCATATTTGTA
AGGTTTAGATACAAAGCATAACATTTGTCTTGAAAATGTTTTTCAAACAAGTTTGATCCTCTACTTGGTAGGAAAAAAACGATTAGTTGCTATAACGACA
GCAGAGATCTGGAAAGACTCTCACGCTCGTATACTATGATCCTCATCGTCATGAGTGCCCAAAAGAGACAAGTAAGGAGGCAATTGGTGGTCATGGTACT
CTTCTTCCTGAAAATACACACGCAACAGACGACAAAATCCACGAATTCGGATACGAGTAGTTGCAATATGTTCCGTGCCAAATGCTTGTATCGATAGATC
CTTGAGATCCATGCACAAATACCGCCATCCTGTTTCAGCGCCAAACAGAAGAGGAATCTGACATTTACATCGATCCGCATCTACTTTCGCAAGACTACGA
GCATTCGTTACTTTCATGACTTTGTATTCCCTCCCAGAGACAAGTATGGTGACATCAATTTCAACAAACTGCTTGAGGTTCTTGATAAAGAGAACAAGAT
ACCGTAGTACGGAAGTGACAGAAAAAACTAGGCCTTCTCTTTGGCCTTGGATCTGAACTACTTGTCCATTCACATCTTCGTCTTTGAAAATCGAGACTTG
ATTATTATTGCGCAGCAGCTCATCTCGAAGCTGCGTCTTTTTGATATCGGGGTGTT