Description :
From Genome Similarity Track
Location :
Scaffold_73:10816- 13183
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_73-fgenesh-gene-0.2Myosin

Sequence
2367 bases(100 bases per row)
GGCGCCGAGGACATGTGCGAGCTGAGCCACCTGCACGAGCCGGCCATCGTGTACAACGTGCGCGCACGGTTCCTGGCGCGGGCGCCGTACACGTACACGG
GCAAGATCGTGGTGGCCGTGAACCCGTACGAGTGGCTCAAGCCGCTCTACTCGGAGCAGTTGCGGGACTTGTACACGCGCCATGCATGGGACGAGCTGCC
GCCGCACGTGTACGCGACGAGCGCCGAGGCGTTCCGCCACATGAAGCAGCACCGCATCCCGCAGTCGATCCTCGTGAGCGGCGAGTCCGGTGCGGGCAAG
ACCGAGACGGTCAAGATCATGATGGAGCACCTCGCGTCCATCTCGACCGGGTTCGCCAAGCAGCTCGCGCCGGAGCTGTCCGGCGAGAGCCTCGTGGTCA
AGAAGGTGCTCAAGAGCAACCCGCTGCTGGAGGCGTTCGGCAACGCCAAGACGATCCGCAACGACAACTCGTCGCGGTTCGGCAAGTTCACGCAGCTGCA
GTTCAACAGCAAATACTGCCTCGTCGGCGCCGAGTGCCGCCACTACCTGCTCGAGAAGTCTCGCGTGATCGGCCAGGCCGCTGGGGAGCGCAACTACCAC
ATCTTCTACCAGCTCGTGAGTGCGCATGAGTCAGCCTTCGGCTTCCAGGAGACGTCGAGTGCGCGCGAGTTCCGCTACCTGCAGGACGAGAAGCTGCTGC
TCGACGGCCAGACGGACCTCGAGCGGTACCAGGTGACGCGCGACGCGCTCGCGACGATCGGCGTGAGCGAGAGCGAGCAGACGGACCTGTTCCGCGCGCT
GTGTGGCATCCTGCGGCTCGGCCAGCTCGACTTTGTGCCGCTCGAGTCCAACAAGGCCGACGCGAGCCAGCCGGTCGGGTCGCTCAAGGCGGCGGCCGCG
TCGGCGGCGGTCTCGGCGGACACGATCACACAGCAGCAGACGGAGCTGGAGCTGTGCGCCGAGCTGCTCGGCGTCGAGGTGGCCAAGCTGAGCCACCAGC
TGTGCTCGCGCACGGTCAAGGCCCGGCAGGAGGTGTACAGCGTGCCGCTGTCGGCGCTGCACGCGGGCAACAACCGCGACGCGCTCGCCAAGGAGGTGTA
CGCGCGCGCGTTCGCGTACCTGGTGCGCCGCGTCAACTACAGCATCTCGCAGTCGCCCGACGGCCGCCAGAACACGGACCTGCCGTCGTACCTGCACATC
GACCTGCTCGACATCTTCGGCTTCGAGTCGTTCAAGCACAACAGCTTCGAGCAGTTCTGCATCAACTTTGCCAACGAGAAGCTCCAGCAAAAGTTCACGC
TCGACGTGTTCAAGACGGTGCAGGAGGAGTACCAGGCGGAGGGCGTCGCGTGGGAGTTCGTCACGTACAGGGACAACCAGGACATGCTGGACCTGATGGA
GGGGCCGATGGGTTTGATCGCGCTGCTGAACGAGGAGTGCGTGCGGCCGAAGGGCAGCGACCTGTCGTTCGCGTCCAAGAGCTCGTCGCTGCACGAGGCA
CACCCGCGGTTCGAGAAGGCGCGGCTGAGCCAGACGCAGTTCACGCTGCGCCACTACGCCGGCCGCGTCACGTACGACACGGAGGGCTTCGTCGAAAAGA
ACAAGGACTCGCTGCAGAGCGACCTGCTGGAGCTGCTCTCGACCAGCTCGAACGCGCTCGTGTCGCTCATCTTTGGCGCGGGCGGCCAGACGGCGTTCAT
GACCGACTCGGAGCTGGCGGCGCGCGCGGCGACACTGATGGACGGCGGCGGCAGCGGCAGCATGGGGAGACGCAGCGTGGTGGGCGGCCGCAAGACGGCA
ACGTTCATGCAGGAGACAGTGAGCTACAAGTTCAAGGCGCAGCTGTCGCTGCTCATGACGGACATCTCGAGCACCGAGGTGCACTACGTGCGATGCATCA
AACCGAACTCGCAGAAGAGCCCGAAGATGTACGAGATCGACGCAGTGGTGAGCCAGCTGCGGTGCGCGGGCGTCGTGGAGGCGATCCGCATCACGCGCGC
GGCGTTCCCGAACAAGATGGCGCACGAGAAGTTCCTGCGGCGGTTCGTGTTCATGAAGGGCAGCAAGGGATCTGCGCAGGCGGGGGCTTCGCCCGAGGCG
ACGACCGTCACCGAGGCGTGTGAGCAGCTCGCGCGGCAGCTGCTGGTCGACTACAAGCCGCAGCAGGACGAGGAGCACACGCGCACGCCGCCGTTCGTGG
TCGGGCGTAGCCTCGTGTACTTTGGCAAGGACGTGCTCGAGTTCCTGGAGCACCAGCGCACGACGTTCGTGCACGACCGCGCGTTGCTGATCCAGCGCAC
GGCGCTCCGCTGGGTCGCGCGGAGACGGTTCAAGAAGCTGCGCGCGGCCGTGACGGCGTTGCAGGCG