Description :
From Genome Similarity Track
Location :
Scaffold_2:1081552- 1083442
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000794Similar to TMEM135: Transmembrane protein 135 (Bos taurus)

Sequence
1890 bases(100 bases per row)
GCCATGGAGCGCGTGTACTCGGCGTTCTTCACGGTCGACCGCTCGAAGAAGGAGACGCCGCCGCTGACGGCCGAGGCACTCGAAAAACACAACGAGCGCA
CTCAAGGCAGCAGCCACGCGAAGAAGGCACGCAGCACCGAAGATGACGCGCGCCCGTCGCTCGACGCTAACGGCCCGCTTGCGCACCGTCCGTATGGCCA
CGACGCGACGACGCGGGAGCAGCGCCGCGGGAAACCCAACAACCGTCGACGCATCCAGGACGACGAAGACGAGAGCGAGTATGCGGACGCGCGTCGCCGC
GATCTCACGCAGCTCACGTTCAATTATGCGTACGTCAAGCGCGATGTGAAAGCGGCGTTCAAGGCCGCGCTGCGAGGTACGCGTGGCTGGGCACAGAGTG
GTTTGAATGGCAATGGTCTACTGATTTACTTGTCCTTTAGTGTTCTTGTACGCGTATGGCGCGAAGGCGTTCACGGCGTTGCTGTTGGCGTCGCGCAAGT
TCAGCAGCCTTGAGTACGGCTACGTGGACGCCGTGCGGCTGCTGCTGCGCGTGGACACGATCCGCTTTGGCGCGTTCTTCGGGAGCCTCGTGGGCGTGTT
CCGCCTCACGGAGATCGCGGCGCGGCTCGCGCGCGCCAAGAAGGACCAGACGAACCTCGCAATCGCCGGTGCCGTGTCGGGACTGACACTGCTGGTCGAC
TCGAAGGCGCGACGCAACACCATCTCGCTCTACATTTTCGTGCGCTTCCTGGACGTTGTCGGGCGCCATTTGACGGCCACGGGCGTGCTCCCGGATTGGA
AATACTCGCCCGAGTTTTTATTCGCGGCCAGCAACTCGGCGATTATGTATGCGTTCATTTTTGAGCCAATGCTGTTGCCCAAGGTAACCTGCGTGCATTC
CTATATACTGCACACATTGACTTAGTGTTTGCTCTAATACGCGCGTATATATAAACACTATTGTGGATGCAGAGCTACTACAATTGGATTTTGAACATTG
GCGCCGTGACGGATCATGGACTCGCGTACACGCTGCGCGAGCGTCTGGAGAAGGTCGTGGACGCCAACGGCTCGCCGATCCCATTCCGCGTCTGCCAGCC
CCACTACCACATGTACGTTGATTCGGCGCTGTGCTCGAAAAAAGTATCATGCATTGATCTTAGGATGATTTTGCGTGTATATTAGGGAATCCTGCACGAC
TCATGGTGTGAAGGAGTGGATCGGCGGCCTCGGACGCGCGGCGCAAGTGTATCTACCTGTGCACATTTTGCCGGCGCTGATCTTCCGGTTCTCGCAGATC
AAGGCCGCGCCGATCTCCTCGGCCGCCAGAGTCTCGTACGCCGCGCTCTGCTCGTGTCTCTTTCTGACATCGTACCAGGTACGCCGCGGTCATGCACATG
ATGAGAAGACGTCGTCTAGCGTAGCGTATATGCTGCTGACAATGCGTGGTCGTGATCCTTTGTGTGCGTGCAGACGGTGGTGAAGCTCGTGATGTGCGCG
ATCCGCAACACCTTCCACCGAGATTTCTCCATCGGCGGCTGGATAGCTGGCGTACGTATCCTGCTTGCTATATGGTTCATATTTTGGAGTAAACGATTTG
CTGATTGCGGTTGCAATGTGTGTATGATGTGGGCGCAGTTTTCGACCGGTGCGGCGCTATTTCTGGAGAACCGCAAGCGCCGCGCGGAGCTGATGCTTTA
CTGCCTGAGCCGCGCGCTGGACATCGTGTGGCGCCTGCTCAAGCGCCGTGGGCTCGTGCGCTATGTGCAGCACAGCGAGGTGGCGCTCTTCTCGCTCTCG
ATGGCCGGCATCATGTCGAGTCCGCCGGAGCACTTCAAGCCCACGTACCTGCGCATCCTGCGCTTCGTCTTCGGCCGCGACATTATTTAA