Description :
From Genome Similarity Track
Location :
Scaffold_39:108124- 116638
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012034Similar to AAT1: AMY-1-associating protein expressed in testis 1 (Homo sapiens)
Pytul_DAOMBR144PYU1_G012033Similar to IDA4: 28 kDa inner dynein arm light chain%2C axonemal (Chlamydomonas reinhardtii)
Pytul_DAOMBR144PYU1_G012032Protein of unknown function
Pytul_DAOMBR144PYU1_G012031Similar to TXLNB: Beta-taxilin (Gallus gallus)

Sequence
8514 bases(100 bases per row)
CAACATGGCGATGGCAGCGGCGACGAAGCCCGCCGCGAAGGAGCTTGTGGTGCTCGGCGGCGGCATCTCAGGCCTAAGTCTCGCGTACTTTCTTCGTCGT
GCGCTCCAGCAGCAGCAGGCACCTCCCGCGCGCATCCGCGTGGTCGACGCCGCGCCGCACGCCGGTGGCTGGATCCGCACGGCCAAGCGCAGCGAGTTCC
TCTTCGAAGAAGGTCCGCGCGGGTTCCGACCTTCGCGCAATGGCGCCGAGATACTGCGTCTCGTGGAAGAGCTGGGCCTGCAACGCGACATGCGCACGGT
GGACGCGGCCGCCAAGTCGCGCTACGTGCTGCGCAATGGGCACGTCGAGGTAATCACGCTCTCTGCTTGAGTGGGTGTTTGGGTTGCACTAATGGTAACC
CGCTGTTAATTGATGGCTTTCTATATAGAAACTACCGTCGAATGTTCGCGAAATCCTCACGTGGCCACTCACGAAAGAGCTCGTCAAGGCCGGCGCGCAC
GAGTTGTTCACCAAGCGAAGTGCTGTGAGTGATAATTTGCTAGTCGGCTGAGTGTATTGTGCCTCATGCTGCTTCTGCTGGTTGCATTGTTGCAGCTCCC
GGACGAATCCATTTACGACTTTGCTTCGCGCCGATTCAGTCCGTTGGTGGCCGAGCGGCTGCTGGACCCAGTTGCATCGGGCATCTTTGGCGGCGACATC
CGCAATCTCTCGGTCCGTTCGTGCTTCAAGATGCTGTATGACTTGGAGCAGGAGCACGGATCTGTCGTGCGCGGGATGCTCTTTGGGAAAAGCCCTGCGG
ATGACACGCTGCTCGATGGCTCGACCAAGTCGGACTTTGTGCGCAGCCACGAGAGTTCGGTCAGTGTGAGCTTCCAGGATGGCATGTCGACGCTCATGAA
CGCGCTTGAGGCCCAGATTCAGGTAACCTGCAATGTCGTAGTGCAGTTGTTGCGTACAGGCTTCCCAAGTTTGTTTGCTCACTTTGCGCGACTTTTGTAA
TGGTATGCAGGCGGACCCGCTGTCGGAGATTCATCTGAATACCAAGGTTAACGCGATTCAACCTCATTCAACTTCAACTTCGTCGCCCCCAGCATTCACC
ATCAAACTGCAAGACAGCACAGTCACACAGCCGCACGAAATCGAAGTGTCTCACGTGTTTTCGACGCTGCCGGCTTTCCAACTGGCGTCAGCTGTTGAGA
GTTCGCTGCCAGCGCTCGCGAAGACGCTCCAGGAGATCCAATTCGTGTCGATGGGCATGGTGCACGTTGGATTCAGCGACCGCGTTCTTGACAGCGATGG
CTTCGGGTACCTCGTTCCGACCTGCGAGCGTGAGCGTGTGCTTGGCGTCGTGTTCGACTCGAACGCATTCCCATCTCAGAACGCGGCCTCGCGGTCCATG
CAGACTCGGTTGAGTATTATGTGTGGAGGTGCCCATTTCCCGGAGATCACGGACTTGGGGCTGGACGAAGTGGAGAAGCTCGCACGGGATGCCGTAAAGC
GCCATTTGGGCATCTCGAAAGAACCCGACTATGTGCGCAGCATGGTTCTCCACAACTGCATTCCTCAGTACCACGTTGGCTTTTGGAAGACGCTCGAGAC
GATTGAGAGTCAACTTGTGCCGGGGATGAGTCTTGGAGGCAACAGCTTCTACGGCGTCGGTCTCGCTGACTGCGTCACGCGGTCCAAGGAGCTTGCGTTA
GAGTATGCAAAGACGATCGTGGATGAAAAATAATTGACGAACCCTCCATGTGCAGCGCAAACAATCAAATAGATACCCTCGATCTACAGAGACGTCCTGT
GTTGGAAATGCCGACGACCTTGGTCACCTCCTATTTTGGTCAATGTCGCCTCTATTTTCTCCAGAAAGAAACGGTTGCCGCCTTGTAAGTATGTCTTTCG
CTCTTTTTTCTGCTTTTTTGAACAGTGGCATGCTGTGTGTCTGCCGCGTCGTATAAAGCAAAGACAAGATGGCGCACCTGGTGCCCACGCGGGCTCTCGA
CTCGGTCTATGGTACGTTCATGATTCCTCATGGCCTCTCTTCGTATTTTCCAAGCTAACGATCTGCATTGTTGCTATCGTAGATCCTGTCTACACAGTCT
CGCGGTCGGGAGGCCGATTCAGCAAGGGAGTGTATCGTGCCTCAGGGTCAAAGCCCCCAACTGCAGCGACAAGTTCGAACAACAACAACAACAACTCGAC
GGCTGGGTATGTGATGGTGAGCGGCGCCGAGCGGCCCAAGTTCTTCCGCCGCCCGATTCTGCCGCATTTGCAGGCCGAACTGCCCGAAGTGCTGCTCTCG
CCACCTGTGCTAGCAACGTCCACCTCCTCGGCTTTGAAAAATCGGCTCAATGAAGAACAGCATGAAATGGCGAGTACAACCCGATCCGTCGGGATCCAGA
CCATGTACCGCGACTCGGATGCGCAAACGGACCCGTACACGCCGGACTACACGATCAAGAAGTCCCAGAGCGCGACGACAGCAAAAGAACCGCCCGAGGT
GCTCAGTCTGCTGCACTTACGCCACAATCAGGGGCTGCCTGCGGGTCAGGCCGAGATCGAACTGATTGAGCGGAATCGGAAGAAGAAGGCGTTTGATGCG
TCGCTACCGCCCATGACGGACGAAGCCTCGTTTTTGCTGCGGAAGTCCATGATGGAGGTCCAGGAAACGCGCGAGTGGGCGTTCCGAGAGGCTGAAATTG
ACCAATTGCACGCACAGCGTATCGCGTTGCTCCAGCAGGCGCTCGTGGAGCGCGACAAGGAGAACGAATTCCTCGCTGAGCAGCGCGTCGAGGCATTGCG
CGCGAAGCTGGTGCATGAAAAGGAAAATGCGATAGAGCGCATCCAGCAAGAGCGCGTCACAGCACTGAGGAAGCTGACCAAGAAGCGGCAGCACGGACTC
TTGGCATCCCCATCGAAAGCAAAGCGCGATATCATCCAGGAGTACACGGACTTTGGCTCAAAAGTGTATGCACCGGTGACACGCAATGGGAAATCTGGTA
AAGTGGACATCCTCGAGGTCGGCATCGGCAAGCAGCAGTACAAACAGATCGAGTCGCTGATCGAATTGGAGGCCGCTGTACCGCCGCGGATGTTGCTCTC
GTCCAAGCTCAAGCCTCCGGAGAAGAGCGTGCGGACCGCGAAGGAGCGCAAACAGGCCGCGATCGAAGCGCATTTGCTGAAAATGGAGTCGATCATTAAG
AAAAGCAAGGAGACCATCGAGGATGCATCACCGAGTTCTTCTCATGGCTCTATGTCCAGTCCCACGCCGATGCGTAGCAGACACAGCAGTCTGCATCAAG
CCCAGGTCATGACACGACCTCCGACACCTGATTACGCGCTGCCGAGCGACGAAGACGACAGCATGGCGGATGCTGTGCGGCTGCTGCAGAAACTCATTCG
AGGCCGCGCGGTGCAGAATATGATGTTCGAGGGCAAAGAGCGTCGTGCTGAGCTCATCCAAGAGCTACGCGCGAGCGACGAAGCCTACAAGCAGGATCAG
CTAGACAAGCAGTTACTTGATGTCGTCGACGACAACAAGGTCGCGAGCGCGACGCTGGCCAAGGCCGAGGGCGAAGTGATCTCGGACATGCTCGATTTCC
TGTACAAGGAGCTCGATCGATCGAAGGAGATCGCCAAGATGCGCGCATTTGTGGATAACGCCGCCGAGGCGCGACGCAGACTCGAGGTCGAAGAAGGCGG
AAGGCGGCAGGCCGAAGACCTGCTGCGCGGCCGCGAAGACGAAGTGTTTCGATGCATCGAGCGCGTGCACCAGGAGACGGCGTCGGACCTCATTCTCGAC
ATTATCGGCGGCGTGATCCAGGAGCAAGCGCACATCGCGGCCATGGACGAGCTCAACGTCATGACCAACGGCGTGAGCAACATCGTGATGCAGCTCGAGG
AGACGTACAACTCGGACGCCGTGATCGTCAAGGAGCTCGTCGCGTCATTCTTGCTGCCGCAAGTCCAGCGGCTCAACGTGCGCGACCAAGTGGCCCACGA
GCAGCAAAAGTACGTCACGGCAGCGCATTCCGTGCTCACAAAAATGGTGCACCAGATGAAAGCAGCCGAGACTTAACTAGCGAACATTGTTTGAATACTA
CATTGCCATTTCTTGCCAACGCTAATGGACGTAGCTTAGTTCGTTTTTCACTTTGGTGCACCGCCAGCACCTCCCGATGCGCCTACACCGCCGCTGGCAC
TGCTGCTACTGGTGCCGCCGCCTGCGGATTTCAGGAACGTGTCGAGGTGCTGGCCCTGGTACTTGAGGAAGTCGAGCTCCTCCTTAAACTTCTTGTCCTG
GAGCGCCTTGCGCTCCGTCACGCGCTTTTCGATCAGCTCGAGCTTGTTGGTGAGTTCCGTGACCTTGTCCTCGTGTTCTTGCTTCTCGCGCTGCAACTTG
TCGATGCGGTCCTGGAGATCGCCCATACCGTCCTCGGCCTGCAATTGTTTGCGGATGCCGAACGTGATGCTGCTGTCGTACAGCGTCTTGTACGCGTCTG
TTGTGAGTCGGATCTCGTCGCGAACGCGAAGTAGCAGCAGTCCGCGCTCGGGGCAATTGATCGCGACTTCGCGGATCAGTTCGTCAAAACATTGCCGGTA
GATGTCTTCGCGCACGGGGCAAATGCCGTTCTCGCGCGCCTGGCGCTTCATGAGCTTGTTGTCCATGTCCTCCTGCAGCTTGATCACGTCGAAACGCGTT
GACGGCACGGGCGCCGCATACCGCATCCAGTACCCCGTGTCTTCTTCACGCCACATTCTAAAGTGACAAAGCACAAATCACAAATTGTTGGTGTCAAATG
CAGCAACAGCAGACCAAAGTCAGCAGCAACAGAACCCAATATTACTGTGGGGGGAGAATCGCATTGAGAATGTCTTCGATGCGGCCAATGCCGTCGCCTT
TCTCGCCCGAGACACCATTCGACGATGACGAAGATGGTCCCTTTTTCGATGGATCCAGGGTCTCGCCTGTGAAAATGGGCTCGCCATAGAGCACAAGCGA
CTCGGGTGGAGTTGGCGCCGCCATGTTGAGTTGCTGAAAATTGCTCCTAAAGCGTTCTTGTATATGACTTTTCTCTAGAAATGCACCCAAACCTTCACAA
AGCCTAGGGACACGAAACGACGCGTCTTTTCGTCATTCTGATACGGAAGAACCACAATAAGGACGAGTCACGCGGAGCAAGAAGCATCAGGCATCTATTT
TATCATCGCATAGGCACTATACGAAGCATAGCTGCTGTCGCTCACCCCGTGGCTATTCGCGGCATGCAATGCTGCTCTGGCGCTCTCTTTCTCCTGCCGA
AGCTTGTCGTTGAGCTCTTTCGTCAGCTGCTCTGGGGTCTTGTACGTCGGCTGGCTCGCCACTTTCTGCTTCCACTTTGAACTGTTGGCGAGTCGCTCGG
CCTCAATTTTGGCAAACTAGCAGGAGAGTTTAGCATCGTAGTTATGAGGCAAGGTCGTTCGACGCTTATATATGAAAAAATGCCACGTACGTGTTCTTTT
CGAGTCGATGGCGTGAGCTCGTTCGACAGATTCCAGGGCTCAGCGTCCCGTAAATCTGGATGGTTTGGTAACTCTTCAGTGCGTTTACCAATCCCCTTTA
TATACAAACACGTAGAGCACCATCAGCCATTCGATCAAAGCAAGTGCACGGCACGTAAAGAGTAAAAGCTCAGGTACCTTTGCCATTCGCTCGTCACCGA
AAGTCTCGCCGATGTATTCGTCCTTTAGTGCGACTTCCAGGATCCCCATGTTGAAGCGATTCGATTTCGGCTTGACCGTTGGGTATTTTTTCGGCAATTT
CTCGGCTCGGAAGTTGTAGACGTACATGTTGGCGCGATTTCTCTGTGCAATTGCAAAAATGTTCATAATTTCGCAATGAAGTAAAGACGGCGGAAGTTAT
TTGGTGACGATGGACGTACCTCGGCATTGACGTTGGTCCGCTTGTAGCACTTCCCATTCATCTGCATGTTGTCATAGTTGGACGTGGACATGTTCCATCC
GGGTTTCTTGCTCGACAGGATCCGCGACTTGAGACTCTCAAGCACTTCTTGCTTGGCCAGCGCTTTGCCACTCGGCGTGTCCTTTGAGCTGAACACTCGC
TCTTCGAATGAGTAGTTCACCGGTGCATCTTTGCCGCCGATCTTTTTCGTCGCATGGAGAACCGCACGCTGTCGAGTCTGCTCCTCACTGATGCTATCGG
CAGCCAAGTCCAAGGTCATTGCCGTGCTCTTCTACGCGTCGCAAAGCGCGTGGTAAACCAACTCGTCTTTTTCTTGTTCCATGATGCCTGTCAAACCTCG
CATTCTCACGTCAGTCAGTCAACTCGAAAATAGACAAAAATCTTATCATCATCCATTCACCGTGTGTATTACATACCCCGCATGCGCACCACACAAATGA
GGCTAAATTTAAAGAAACCATGCAATGGATGGGGGGATTCTCGCCATATTCAGCTCTGCTTTCTTTTTTGTCTTTCTGTTTGTTTCTCGCTTGTAGCACC
CGTCAAAATCTTCAGCTTAAGATGTCTAGGCGGATTCAGGCACGAGCGGTTTCCCCTCGCGGATGCTGTTGCGTTCGGCTTGCAAGTGGCGACAGAGACT
TTCGAGTTTCTTGATTTTCTCGAGGTACTTCTGCGTTTCTTCCGCAGTTTTGACCTTGTCCTGAATCGTCGCAATCGCGTTCGTGTCGTACTCTGCGCAT
TTCTTCTTTAATGCCGTGTTTTCCTTCTCAAGCTTTTTCGTGTGTTTAGCCATCTATCGCATACAAGTAGAGCAGCGTCAGTAAGATTGTAATAAAAAGG
TTGCCAAGAGTTTACGCCCAACCTTGTCCATTTCGTCGCGGAATGTCGTGAACATTTGGTTGCTTTTATTCAACGTTTCCTGCACAATATCAAATTTCTC
CGAGTACGAGTTCAATTGAGCCTGCAAGCCACAACAACATAGTCGTCAGCTTTGCAATTTTTCAACAAATTCCACTTTTGAAAATAAAAGTCGTTACCTG
CAACTGCAATTCGCGGTCTGAAAACTCTTTGGCTTTGTCAAGCGCGAGTTTCACTTTTTCCGATTCACGTGCTGTGATCTCTACCTGGTGCTGCAGTTTT
GCATCTGCGAGTTGCACCGTAAGATCCTTGGCTTCGAGCTGCTTCTGGAAGTGCTCTTCGCGCACAGTGTACTGTTCGAGGAAACTCTTCAGCTTTTGTT
GAAGACTGGCACACGAAGAAAGCAACCAAGCAACACCGACGACAAGACAGCATCAGAACCAAAAGCTGCAATACGACGCATTCACTGGACATCCGAAAAT
GCACCTTTCGTTTTCTTTCAATGATGCCACGTAGTCTTTTCCCTGCTGATCCATCTTCGCGCTCACTTCTTCAATCGTTTTCTGAAACTGTGTGGACAAC
TCACGACTGAATAAAGCAATATCATGGGAAGACATTCGGAAAGAAACTGAGTGAGAAACAGATTCTAACGAATCGGAAGGGACCATTCGCATCATTACTT
ACCGCTTCTGATCTTCTTCGTCGGCAATTCGGCGGCTTTCACTCTAGTAAACCAAGCAGCTCGTCGTCAGACTTCTTCACATTATCATGCAATGGGAATA
AGAAAATGCAAGTGGCCACGTGCCACAATCAGCTTGTTTTGCTTTTGCAGCTCCCGGCACAGTTGCTCCAATTTGCTCTTGGTCGCATTCGTTTTCACCA
ACTCCGTCGTTGCTACACGTCAAGCAAAACAAAGAAAACAATCCCAATCAGTTTTCAGTTTATAAAACAAATCATGTGAGCGAAAAGCATACCCGTCTGC
TTGCGCTGCTTCAGTAAAATGCATTTCGCATTGAGTTCGCCGATCTTTTGCTGCAGCTGCGCGAGTTGATCACTCTATAAAGCAAAGAGAGGCACAGTTG
TTACCGCTTCGATAAAACTTGTCTCTTTGTTTGCAGCATGAGCGAAACGGACACGCACCGCTGTCTTGACTTGAGCAGCGAGCGCGTCCACTTTCGCGTC
GGCGCCGAGTTCTCCATCGTCCAGCACGCCTTGCATGGTCTCGAGCGTCTGCGCAGGCAGCGCCTCGTCCTGGTAGATGCCTACACAGTGCAAATTTTAT
GCATGCAACCATGATCACTACACTTATATCTTCGTTAACGGATAACAAAGCATATACTAGCTTACCGGAGAGATCGATGGGCGTCTCCAGGTTCTCATCG
CCGCCCACTTGGAGCTCGGCGATCTTGCTCGTGAGAAGCTCGCGCATGACGTCTTCGCCCTTCGCAGCGCTGCCACTGGCCGCAGCGTTTCCGGCGCTGC
GCGCATGGCGCATGCTGTGGTGGTGGTGGTGGTGCGCGCGGTGGTGGTGATGCGCGTGCGCGTCGCTCGCCGCTCCGGCGATGGCTGCTTTGTCGTCGCC
GGCGGCATCCGAACCGCCGCTGCTGGCCGCAACCGCAGTGGCGGCTGCTGCGCGCTTGTTCTTGGACTTGTGCTTGAGGTTCTTGGCGTTGCGGCCGTGC
TGCTTGAGCTCGAG