Description :
From Genome Similarity Track
Location :
Scaffold_133:108087- 109090
Transcript NameFunction/comments
g4486.t1RAW37349.1 hypothetical protein PC110_g6379 [Phytophthora cactorum

Sequence
1003 bases(100 bases per row)
CGATGACCGCGCTCGTCTGCATGCCTGTCCGTGCAGCAGTAACGAGCTCGAGAATGCGGCGTCGCTGTGTCTCCCCGTGGACTTCGCCGGTAAGAGGCCG
CAGAAGGAGATATTTGCCTTCTCTGTGGCGACCGACGAGCGCTGGAAGCACTACGACTGGGATCAGGTACGCACTGCTGGACGGATCTTCTGTGTCGTGG
GATCACATTTACGGAGACGTTGTTGGAATATGCCTAGCTCACGACGGTGGCTTGGAACGAAGACAAGGAGCTACTCTGTCATGCCCACAGCAAGGGTGTG
AAGGTTGTTGTGAAGCACAACTTTGATGACGTGGACCAACTGTGCAACGTCACAGCACGCCAGGAATGGATCAAGGTAAAGTGAGCGGCATCGATCTCGC
TGCTAACAGAGCTCAGCACACTGATAGGCAGTCTCCATACGGGTCATTGATAGCATGTGCTTCGTTGATGTAGGAGACGTACTCGAAGATCGTGGAGAAC
TACGCCGACGGTGTCAATATCGACACGGAGAAGCCCATGTACGGCCGCACGTCGCAGTGTCTCGGCGCACTCGTGCGTGAGCTGCGGCAAGAACTGGAGC
AGCACGCACTCACGAAGAACGCGCAGGTCCGTTTCACAGTTTTGCTCTTTAACGACAGATAACAGCTCGCACGCTGACGCCTTTTGCATGTGTCACGTTC
GACTTTGGCAGATCACGTTTGACGTTCCCTGGGCCCCTCGCGGCGTGGATGGTCGCTACTACCCATGGCGCGAGCTCGCGGACGCCACGGATTTTCTGTT
CGTCATGTCGTACGACATGCGCAGCCAAGTGTACGACGCGTGCGTGGCTGGCGCCAATGCGCCGCTGGCGCTCGTAAGGCAAGGGCTGGAGGAGTTCCTG
CTTGGCGTCGGCGTCGCGCCCGACAAACTGGTGCTCGGGGTGCCGTGGTACGGCTACCAGTACCCGTGTCTGGAGGGTGAGCAGCCGATTGACGGTGCCG
CCT