Description :
From Genome Similarity Track
Location :
Scaffold_16:108086- 110093
Transcript NameFunction/comments
Aphas_H257_07262ATP-binding Cassette (ABC) Superfamily

Sequence
2007 bases(100 bases per row)
TGGCCCGTCGCACATCGTCTCCATGGATGTGTCCCTGCAATACAGTACCGATCAGCAGCATCAGTCCAAGCTCCATTTTTCCACTAGCCATGGCGGTATC
ATATCAATCGGTGAGCGCGGCCGACGACTTTGAGTCGCGGAGCCACGAGGTCCACCCCCAGGACAACGCTGGGTTCGTGTCCCGCATCCTCTACACGTGG
GCCACGCCGTTGCTCTCGCTCGGCAACGCGCGGCAGCTCTCGGCGCGCGACATTTGGCCCCTACAGGTCGACAACCAGTGCAAGACAGTTAGCGCCACGT
TCGAGCCGCACTTCCAGCGCACCCGGTCGATTGTTCGTGCGATCGTGGCTTCGTACGGATGGCGGTTTCTCGTGGTTGGGTCCATGCAAGTGCTGACCGT
GGGCTGCACTTTGTACGGCCCTGTGGTGCTCAAGCGGATCCTCACGGCACTGGAAGTGCCCGACTCGTTCAACCTGCGCGGGGTGCTCGTGTCCATCGTG
TCGCTGTTCGTCGTCAAGGTCGCGCAAGCCGTCATCACGGCGCACGCGACGTTCCAGAACCAACTGGTCACGGTGAAAATCACGTCCGCATTGCAGCACT
TGCTGTTTCACAAATCGCTCGTGCTGGACGCCAAGTGCCGCCGCGAAAAGACCGCGGGGGACATCGCCAACATGTTTTCCACCGATATCCAAACGATGAT
CAACTTTTCCATCTTTGCCAACCAACTGTGGCTCATCCCTGTCCAAGTCGCTGTGACACTGTACATGTTGTACGACGTCATCGGATGGGCGACGTTTGTC
GGCACCGGCGTCATCTTTGTGACGCTGATCCTCAACAACTTTCTCGCCACGGCGCAGCGCAATGCGTTCAAGGAGCTCATGACCCGCAAGGACGCGCGCA
TGAAGTCTATCAACGAAGTGTTTGGCGCGATGCAGATCATCAAGCTGAATGCATGGGAAGAGAAGTTCCAGGACAAAATCAAGACCGAGCGCGACAGCGA
GCTCCAGTCGCTGTGGCGAATCTTCACCGTGTCGAGCTCTATGACTGGGTGCTTGTACTCGGCGCCCGTGCTTGTGAGCGTCGTGTCGTTTGCCACGTAC
ACGATCGTGATGCGCCAGCCATTGAACGCGACCAAGGTGTTTACGGCGCTCACGCTGTTCAATTTGCTCAAGTATCCCATGCTCACGCTTCCGTCGATCA
TTGCCAACTTGATGCAAGCCGCGGTGGCCCTTCGCCGCATCATGGATTTCCTCAACATGGACGAAAAGAAGACGCACATCGTGCTGACCCCTTCGTCTGC
CCCCGCTGAGATGGTCGAAGTATACGCCAATGGCAATGTCGACATTTGCGTGGACAATTGCAGCTTTGGCTGGGACGCTGGCAAACCTCTGTTTAAGGAC
GTCAACTTGACCGTCAAGCGAGGCGAGTTTGTGGTTGTGCACGGGTCGGTGGGCGAAGGCAAGTCGTCGCTGTGTGCCGCCTTGTTGGGGGAAATGGACA
AATTTGGGGACGGCACTGTGTTTGTGGGCGGCCAAGTCGCGTACTTTTCCCAACAGGCGTGGATTCAGAACATGACCATCCGTGAAAACATCCTCTTTGG
CAAGCCCTACGACCGCGTCAAGTACACCAACGTGTTGGAAGTATGTGCGCTTTCGAAAGACCTGGCGCTGTTTTCTGCCGGTGACCGGACCGAGATTGGC
CAGAAGGGGGTCAACTTGTCGGGGGGACAGAAGGCCCGCATCAGCTTGGCCCGGGCGTGCTACAGCGACGCCGACATTTTCATCCTGGACTCGCCCTTGT
CTGCTGTGGACGCGATCGTGCAAAACGAGATTTTCACCAAGTGTTTTCTCGGATTGCTGCGCCACAAGACAGTCATATTGGTGACGCACTCACCGGAAAT
CATCGCGTCCAAGTGTATCGACCGGATTGTCGAAATCAAGAGCGGCCACCTGATTCAAACCACTGTCGTGGACAGCGACAAGGCCGACCAGCCTATTCTC
GTCTCCC