Description :
From Genome Similarity Track
Location :
Scaffold_820:10808- 15039
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_820-snap-gene-0.6Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_820-snap-gene-0.7Gene of unknown function

Sequence
4231 bases(100 bases per row)
CAATTTGACTTGACTCTCAAGTTCCTGGTTGCAGGCTTCTCGCTGCAACAATGTGCCAAGCTGATTCAAGAAACGGACCGGACTCAGACAAGTTCCCACT
ATCACTCGCAAGTTACCAAGTACAGTCGGTTCATTTGCGCGATGAACTTTCAAGCAATCGCCAACATGCTTCGCTCTGCGTGGGCGTTCTCGCTGGTGCT
CGACGCTGGAAGAGATGGTGAGGCGCCGTACACGGACATTCGCGTGCGCTTTGCTGTCTCTGAGAAGATCCATGACGTGCATCTCGTGACGCTGCCTAAC
GACGAGAAGAAGAGTCAGAGCCCGAGAGCTTTGATCGAGCGCGTGACGCACGCTATTGCTGCAGTGTGTCCTGGCAGCTGGCAGGCCAAGCTCGTGGGCA
TTGCAACCGACGACTCTGCGAGCGTCACTGGGAATGGCCACCTTTCGGGTGTGTTTGCGTTCCTGCAGCAAGCGGCGTCTTCCTCGGGATGCTACAGTGT
GTGGTGTGGAGCGCGTCAAGTTGAATCTGTGATCCAAGGAGCGTTCTCGAAGCTTTGCGACGACAAGTTTGTGTCAACCTTGGTGGCATTGACGGGCTAC
CTCCGACGCCGCAAGAAAAACCTCATTGGGTCAAGTTGCTGTCCAGCGTTCAAGAGTTCCCACTGGATGTCGGTGCGCGAGTTGTTGACATGGCTTGTTG
ACAACAGCGCAGCGTTGCGAGAGCACTTTGACCTCGAGAAGTCGGTGTACACCCCCGAGGGCTCGTGGTGGGTTGCAGTGTACTCTTTACAAGCCGTGGT
GAAGCTAGCGAGCGCGTGCATGCTCAGCATCGAAGGGCTCACGACATACGGAGCGGAGCAGAACCGTTCGATCGAGAAGCTGCTGATCACGCTCGTCGCA
GATGGCTACGTCGATGGACCGAGCCGCTTCCAGGAAGCCAAGAGTTCGGTTCTGAAGGGAGAGTATCGCGTCACGTACGAAAGCGCCGAGATGTTCATCC
AGAAGCAAGACCCGTTCGTTGCTGAGCTCTTGACGGAGTTAGGCAATGGTAACCGGGAGCAGCACACCAAGGTACTTGACAACGTCGCAACGATGCTTGC
AGAAGCAACAAGTGATCTGGCGAAGCTGCGATCTGAGCGAGCCCGGATGGCTGGGCTCTCGGACATTCTGCCTTCCGTGCGCCCGCAAGATTTGGTGAGA
ACGACCACCGAGTTTGATTTCAGGCGCTTGGTTTCCTTGCAGAGAGATCGGCTCAAGTTCTCGCTCAGAGACGACGAAATCAAGACGATCGAAGAGGAAT
TCAAGGGGCTACTTGCTGCGTACAAGAACGAACAAGCGCTGAAGAAAGTGCTGGACTCGCTCCCACCGAACGCGAGCTTTGCCAAGTCGTGGAAGAGTCT
GAGCGAGCGTTTCCCATCGCTCTGTCGCTTTGTGGGCGGCCTTGCGAGCGTCTATCGTGATCCAAGAGCGGTTGGTCTGGATTCCACCTGGATAAGTGGC
TCTTCACAAATCCCGCTCTCACCAGCTGTCACGAGCGTTGTGCTCGATTCAATTCTGCACGCCAAACAGTTTGCAATTCTCCAACAATTGTCGAATGACT
AACTCACTGGGTCACATGTAAATGACATGTTGTCATGAACAAATATAATGGTGTCTTCATCTTTGTCTTTGGTGAACAAGTGCACGGAGATTGATGCGGG
TGAGTCGTTCGGCAATGCGTTCGAGCACGCCGGCTGGCCTTGCGTCGCGACAATCGTGACGACTGGTGAGATGTTCACGATGCCGATTACAACGCTCATT
AGTTTTCTCGCACAGCCGCGCGTGCAGCACGCGATGGCGACAACAACGGCAACCTGTTCCACACCCGCTGGAACTTCATCTTGCTCGCGGCAAGCATCGG
GCAAATATGTTGAAACGACTGTGAAATGGCCCACATATCCTATTTTAGTGTACATCTTGAAAAGCCGCAAATGTTCAAAACTTCATCCAGAGTACAAGTA
AGGAGCCATGCGCGCACTCTGCTTCCGCTCGAGCGTCAAGCGTCAGTACTTCAGCGCCGCGCTCTCCGCTGCGCACATCGTGTCGTGGACGCTCTTCCTC
CTCGCGCTCGTCCTGCCTCTGCTGCTGGCGCACGGCTCGCACGGTATCCACCAAGCCACACCTTATCTTGTCGCCGCATTTATTTGTACGAAACCCCCTT
GCTGATTGTCGCCTTTGTTACATGTGTATGTGTGTATGATTCCAAAAGACTTTTGGGTCCGCGTGAACACCTATCGCGAGCAGCCCAAAGTAGCGCTGAC
GTACCAAGTGGTCAGCATCCTGGAGGGCGTGACAGAGGACCCAGCGACCCGCGCGCAAGAGCATCTGAGCATCGTCCAGACGACGTTCCCAGCGCGCATC
CAGCAGCTGTTGCAGGAAAAAGCCCGAGCGTCCCAGTTCAAGGTGAGCGGGCAGTGTTTTAGAATTGTATCGATGATGTACTTACTATCTTACTTTCCAA
CCCGCTAACGAACCCTGTGGGTGTTGGCTGTTTCTCTATCGGGTGCAGTCGTATGAGACGGACGAGAATCGAGATGGGGTCCCCGAATCGCTTCATGTGG
AGATCACGACTCCGCTCCATTCAAACGAGCGGATCCACGAGGTGACGTTGATCGCGATTCTCAACTTCACGCTGCAGGTACGCGCACCATTAGTATCGCT
TGAGGTTCCTGGAAGAGTTCGATTTCGGATATGCAACTCACTTGCTTTCTTCATCACTAGGGTCACATCAAGATGAACATGGACGCCATTGTAATGTACT
CGCAGACGTCTCCGCTTGCGGGTGAATCGCTGCATGTGGATGGAAATCTCATTCTCGAGCAACGCGAACCGATCCACATCAAGCAAAGGTATGCATGTAT
GTGGGTGGGTACGCGTCAAAGACGAGTGCAAGTTTATTGTTGAACATATTGAGCCTGACGAAACGAGTCTTTCCACTTGCCATTCAGCACGCAGTACCTT
TATGAGTCCTCGCCGCTCTTCAACATGTCCAAGATCCAGTCTGCCCAGGACCTCAACTTGCAAAAGCTTGTCTCGCAGTACCGCCAACGCGATTGTGAGT
GACGAGTCGTTGTCCCTCATGATCAGTGTTAGATTTCGCTATACACTTTGTTGTCGGGCTGAACTCAACATTTGGTATATGCCAACAAACAAACCCAGGC
ACGACGTATTTCCAGAGCCCGCTCCCTGTCTGGACGAACGACGTCGGCAGATTCACAATCGCCACACAGCCTCGCCAGTTTCGCACCAACATGGTCATCC
GGGTCCCAACTACTGACATCCTGCAAGTGAATTTGCATCTTGAACGAGTGGCGGGGTTGCACGATGGAACTAACCCGTGTAACTCTCATGGTTGCCATTT
GCTGCTGAGGTAGGTACTTTCCGTCGTGGTCTGAAGTCTTGAAGAAGGCGTGGATTCAGGTAAGATGCTCCGTATCCTATCGTACCCAAAGCCTGGAAGT
CAAACGCTTTTGCCGCTTCAAATTCCTCATGCTGCCAGTACTACTGCATCCTGGTGATCGTCTCGACCTCGACTTCGTACTTGTGCGAGTTTCTCTTCAA
GAACAAGGTGCGCAACGCTGCAGCAAATAACTACTTGGCCGAGCCGAACTGGAAGGGTCTAACCTACTAGTGTGGTGTTGTGGGCGTGTGTCGCAACTTG
TCTTCAGATGGTGGACACTTTCTCTGTGATTGACGATCCTGTGCTCGTTGGGATCAAGAAGAAGTATGTTTGATTTTGATGCAAGGAAGGACACAAGGGA
TTACCTCTGTACGAGGTACACCCGTCTTGTACGGAGGAAAAACGAACCGCCACGAAATTGTAATGTTTTCAGTACTCGATCAGTTTAAAAGTTGAAATCT
CGTGGCACTATACACAGTGTACTAAGTATACATAGTCTACACAGAATTTACACCGACTACACGGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
CGCCACGATATTATAATATTTACTATACAAAATAAGGTCAAACATTGGAATCATGTGGCGATAGCCCGAGGTAAAGAGGATCAGTTGTTATCTTTTTATC
TTAAGAACCTGTACTCATTATACAAGGCAATGTGCACGTAAACCAAAATGAAAAAACCTTAAGGTTTGTCTCGTCTTCAACAATTCCCAGCCGGTATCGT
ATCGGTACTTTACAAAAAGGGAAAATTCCAA