Description :
From Genome Similarity Track
Location :
Scaffold_594:10803- 14112
Transcript NameFunction/comments
Phypl_g9660hypothetical protein
Phypl_g9661hypothetical protein

Sequence
3309 bases(100 bases per row)
GACCagtcttcttgtcgctgaAGCCGGGACGCCTGTCCATGCTCGAGTACATCCAGCGTGCCCGTCACCTCGTGTCATGCGTCACGGCGAAGCCGATGGA
CATGGCGACGCAAGTCCACGTCTTTGCCTCCGCCATGAACGATGGTTACCAGCGTTTCTATTTGACGAGGAAGACCCCGAGCACACTGGAAGAGGCCTTC
GCGGTTGCACTCCGCGAAGACTACAGCGTGACGGCATCGCAAGCATTCGACTTCTCCCGTCCTCTGGCGACAGCTGAGCCAGAGCCGACACCCATGGAGG
TCGACGCCATTCAACAACACTACGGCGGACGTCGAGAGCCGACGTCGTTCCAACGGTCACCTCATTCCTCGACGACGCGTGGGTCGCGTCCGATGCGGTG
CTTCCGTTGCCGGAAACCGGGACACCGCGCGGCGGAGTGCTGCGCGCCGGCGCCTGTAGTGGCGAACGTCACAATCGAGAACGACGTCGCCGCACCAAGA
AACGGCGACATCCAGTAGGCGCGGGGCATCGTACTGGGCGTGGAAGGAGAGATGGATCTCTGGTGGCAGATCCTTCTCCTAGCCCTCATGTGCTTCACGC
ACAACTCTTTGCCACCACctccggcagcgactcgagacTGATCATACTCAGTCTCCATGTTGAAGGCGCACAGCGCCCGATACGTGCACTGCTGGATTCG
GGCGCGACGAACAACTCCGTTCGCGCAGATAGTTTGTCGGTGTTGCCGACGGACATGCGTATCCGCGAAGGTCCTGGCCACATGATCGTCAAGTATGCTG
ACGGAAAACCGCACCGGCTACCCCGGCGCTCGGCCACCTTCGCGTACGTGTTCGATGGATTCTCTGGATCGGATGACTTCCTTGTGATCGAGCTGGGCGG
CTCCTTCGATTGCGTCTTCGGGATCCCGTGGCTCGCTCGCCACCAGCCACACATCGACTGGTTGACACGCACTGTCCGCCCCCGCGACATCGACGTGAAT
GCGGTGTTAGCGTTCCTGAGCGGAACGCCCAACCTTTGGCCACACGTTGCAGTCATGGATCCAGACTCCATGACCACTGTTGCGCCTGAAGTGAGCGATG
GCCCTTCATGTGCAGTTTGTGAGAGTGCAGCTTGTGCCGGTTCTGAGCAGGAGCCTCCGGACGAGTGTGGCGCGGTCGAGCAGGGGTTCCCGCGTCCTGG
TGAGCAGTGGCTCACGAGTGAACAAGTCGTGGTTGAGCGTGGTCTCCCACACGCGGTCGAACAGGGGCTCTCGCGAGTGGTCGAGCGGGAGCTCCTTGAA
GTTGAAAAAGTGGTAGAGCGTGGCCTCCCACGCGCGGTCGAGCATGGGTTCCTGCGAGTGGTCGAGCGGGAGCTCCCTGATGAAGCAGACGCGGTCGAGA
TGCGCGGCCCGCGTCCTGGCGCCGATGAAGTGTCTCGACGCTCAAGTCCAGCAGATGTGATCGAGCGTGGGTTCTCACAGTCTCTTGTTGCGGATGACAT
TCAACGTCccgtccgtcgtcgcggccGTCGTACGCCCCGACGACCTCGCACCGTCAGTTGCTACTAAGTCCGAAGTCATTTCGGTCCTGACGTCCTGCAC
CGCGGACATGTCTCCACACGTACAAGACGTCGAGGTCGCACGCCCCCCGTGCGACGCCGCTGCCATCACTGCGCTCCCCGGCTTGTCGTGGAAACACTTC
CTCCGCGACCTGAAGGGTGGCGAGATCGAGCAAGTGTGCATGATCATAGCGGATGACGCTGCATCCCTCGCAGCGGTCGAAGTCAAGGCCGAAGACTCCA
CGTCCGACGCTCTGACGCGCCCGAAAGGGGCAGAGCAGAAgagcgctcgcgcagcgcgctACGCTACTCAGTAGTTACCGGCTCCCGAGGCCGCCGGCAA
CCCAGTCGCTCCTCTCGTTCGCGAATTCATGGAGATCTTCCCAGACACGGTCCCAGCCGTCCTTCCGCCCGACCGTGGAGTTCGGCGCGAGATCGACCTC
GTGTCGGGCGCGAAATATTGTGTGACGCGGCAGTGGCCGCTTCCCCGTgatcaagttgaagcgatcgacgccttcttcgagAGTCGCCGGCAGGCCAGTC
ACGTTCGTGAAAGTCTGTCTCCACATTCCAGTCCGACGTTCTGCGTGAAGAAAGCTACTGGTGGATGGCGGATCGTCCACGCCTTCAACAAGCTCAACGA
CGCCACCATCccggcgcagacgccgatCCCGAGAAAAGACATGGTGCTCGACACCATgtccggcagcaccacgtacAGCGCCATTGACTTGATGGATGGC
TTCTACCAGATCTTGACgcgcgaagacgacgtgCCGCTGACTGCTGTCAGCACGCCCAGCGGAATGCTTTGGGAATGGCTTGTGATGCCACAGGGGCTCA
AGAATGTCCCAGCCACCTTCAACCGCATGGTGTCGAATTTGTTCCGACCGTACCGAGGCTTCGCGCCCAGCTACTTCGACGACATCTTCATTCACAATCG
TGCCGAAGACGGCGTGACGGACGTCGAGGTGCATCTGCAACACCTACGGCAAGTCTTCTAAGTGATGAGGGAGAACAAGCTGTACGCGAACCTGAGGAAG
TGCATCTTCTGTGCCCCCGAGATTCGAGTGCTCGGGAGCTATGTCAGCATGGACGGTGTCCGTGCTGACCCTGAGAAGATCGAGGCAATCTGTGCTTGGC
CCACGCCTCAGGGTCAGAAGCAGCCCCGACAGTGGGTGGGTCTCGCGATGTACCTCCACCACTACTCGAAGAACTTCGCGTCGACCATCCGTCCGCTGTC
GCAGCTCCTCAAAACCGACACCACGTGGTCGTGGCGCCCAGAGCATCAAGCTGCCTTTGACGCGGTGAAGACGAGCTTATCCACCGCACCCATCCTGATG
CTGCCCGACCACTCGAAACCCTTTCACGTGGTGTGCGACGCCAGTGATTTTGCTATTGGCTGTGCCCTTATGCAGTTCGATGATGATGGACGCGAACGAG
TGGTGAGCTACCAGTCGCGTCAGCTGAAGCCGGCGGAGCGAAACTACCCCGTGCACGACAAAGAGTTGCTGGCCATGCGCTATGCACTTATCAAGTTCCG
TGTGTACCTGCTGGGCGCGCAGACCTTCGCCATCTACACGGATCACGCGTCGCTGcgaacagcgacgaagagccCTCACCTGTCCCAGCGCATGGCGCGC
TGGCTTTCGCTGTTCTCCGAGTACAACTTCGTCGTCCACTACAAGCCGGGCAAGACCAACATTCTCACCGACGCGCTCCCGCGTCGGCCGGACTACGTGC
AGTCGGGTC