Description :
From Genome Similarity Track
Location :
Scaffold_1180:1080- 5851
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1180-snap-gene-0.4Heat Shock transcription factor
Pytve_DAOMBR484maker-pve_contig_1180-fgenesh-gene-0.2GE12523
Pytve_DAOMBR484maker-pve_contig_1180-snap-gene-0.5Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_1180-snap-gene-0.8SGS; HSP20-like chaperone

Sequence
4771 bases(100 bases per row)
CATGGCGAAGCGGGTCCGCGTCTCGAAGGGCGAGGGCGACGAGAGCCCCGTCGCCGTTCCGGCTGTGGCGACCGGCGCGCGGGCGGCGAAAGGGAAGGCG
GCGCCGGCTGCGCCGGTGGCGGGCGGGGCCGAGAACAAGCACGTGATGCTGCCGGCGTTCCTGTCCAAGACGTTCGAGATCTTCAGCATGCCCGAATTCG
CCAACATTTGCGGATGGAACGCGAGCGGGGACACAATCATTGTGTCGCAGCTCGAGGCGTTCGTGGCCATGGTGCTGCCGCGCTTCTTCAAGCACCGCAA
CTTCCCGTCGTTCGTGCGGCAGCTCAACCTGTACGGCTTCCACAAAACGGTGCTGGACTCGAAGCGGCTCGAGTTCCAGCACCCGTACTTTAAGCGCGAC
CGGCCGGACCTGCTGCACCACATCAAGCGGAAGGTGTCCTCGAGCAGCGGCCACAACAACAACCAGGCGCTCGTCAACTCGTCCGCTCAGGTATAGTCCC
GAGTGTGTTCCCGAGACAGTGTTGGAGAATGAGTGTTCGACTGATGTGTGTCGTCATTTTCCGTGTTTCCTTGCAACAGAACTCTCGCCTGGACGCACAC
CGCGAGATCTCGGACACGCTGCTGCGGGAGATGAAGGAGCTTCGGCAGCGCAGCGACGCGATGGAGAAGCGTCTGCGCGAGCTGGAGATCGACAATGCTG
TACGCTCCCAAGTCGACTGGCATGTTGTGGACGGCATACTAACGCGTGGATTTTTGTGCCACAGATTGTTCGCAGCGACAATGTCAAGCTGTGGAAGCAC
CTGGAGTCGGCCAAGGACAAACAGCTCATCATGCAGGAGAAGATGAAGAAGATCATGTGGATACTGTACCAGATCTACCGGGGCAAACACCCGGCGATTC
CGAAGCTCTCGACTGCCGACGGCAACACGGTCATCAGCGACGAGTAAGTGCCATTTTTGTTTTGATATTCCATGCTGCGCTCTGCTTCGTGCAAGCGTGT
GTGCCATCCATGTGTGGCAAGAAAGATCGCCGCGCTCTTTTTTTGCTAAAGGATGTGCTATGCTGTATCGCTGTGCATGCATGCGTGCCCCTGCGCCGTG
GAACCCGAACGTGGACGGTTGGTCTGATCGTAGCTATATCAATAGCAGCATGCTCGGCCCCAAGGAGTTCCGCGAGGTGTTGCGGTTCTTGGCCATGGAC
GAGCCGGCGCTGCTTCCAGACTCGTCGATGAGCGTGGACATTGCTGCTCCGGGTCAGGCGTCGCGGAAGCGCAAGTTCGTCGAAGTTCCGACGGACGTCG
GAGACTTGGAAACGCTGAATGGTACTGGGTCATCTCGAGCTCTAGGTGACATTGGTGCCTTGTTGAAGGTGCATCGTCGCTTGAAGAATTGCTGACGTTT
GTGTGTTGTGTGGTGTACAGAGCCATCGTCGTTCCTCCAAGTGGGAAGCCCGCTGCCAGCCAATTCTCTGGCCATGACGGTGCCGACTAACCCGCTCCCA
GTCCTCACTCCCGAAGACAACCGCAACAACGTGCTCAGCTTGTTCTCCCCGATCAACGTATCGCCGCGCAACAGTCTGTCGGGCACTCCTCCGACTGCCT
CTGGTCTTGCTCTGACGAATGGCGTCAGCACCGAAGTGAACACGCATCCGATGACGCCTCCCCCGGCGACGCCAGCTCACAGCGCAGAGATGTTGACGAC
CCCGTTGAATGGAACTGTGAACGGCAGCAGCACGACTTCAACCAGCAGCGCCGTTCCTTCCACGAGCGACAGTATTGTTGCCTCGATCCCCAGTAGCATC
ATTCCTCATCTGCCTGTCAACCAACTGGGGCTCGGTGACGATGATCTTCCGCTGTTGAGCGATTCGGAGGGGTATTCGTTCGGTGACGGGGAAGAGGTAC
GACTATTTGTGCCGCTTGGTGGATGTTTGTTTGAGAGCTCTAGCTAACAGAGTGGTTGATTGGTGTGCCTCCCTGCTAGCAGCACGTGATGAAGAAGCTG
GAGGATTTCGAGTCGTCCTTGCTGGACGAGTACGACGTCAACTGCTTGGACACGCTGTTGCAGGTTCGTCGAGCTTTACAGTTCTCGTTCTGGAAGTGGG
CTGAGGTCTCACGTGCTCGGCTCTTGATGCATTTGACAGCAACTCAAGAACACTGCCGCTGAGAAGTCGTCGACGCTGCCGCCGGTTGACCCCGAGGAGA
TTTTTGTCGGCCCTGAAGACGGGACGTCCCACACCGCGTAGGCCGTCCGGCCGATGTAAATAGTGGAGCCCCACAGCTGAAGACCACCCTGCCAGCGTGC
CTCGACGTCCGAGTTTTGTCGAAAGAAGAAGCGCAAGACCGGCGGCGAGGACAGCGATGTATCTTGGAGTCGCTTCGCACCCGAGGCGTCTCTGCGCGAG
TCCGTCAGTCGGAGCCGCCAGCGGCGACTTCGCGGTGCGGAGGTGTATCAGCTTCTTTTATTTAATCAAAACAAAACGAGAAAGAGGTTTGCGTCACCAG
ATCGAGCGACAGCTTCTTGTCGATCCACCGCCGCGCTGAATCGTGAAGCGCCGTGACGATTTGTTCAGCTCCGACGGCGCTCAACGTCCTCGAGCGCGCT
GCGGAGCCGCTGGATCTCGTTGTCCTTGCGCTTGAGCTCGGTCTGGGCCGTCGCGAAGAGCGTCGACAGGTTGGCCTCGAGCACGCCGTTGGCCTCGCCG
AGTCGCCGGTTCTCGGCCTGCAGCAGCGCCAGCTCGACGCGCAGCCGCGCGTTCTCGTCCTCGGCACGCGCCTTCTGCCGCAGAGCGTCGGTCTTCTCGA
GCGCGCTCACCGACGTGTCCAGGTCACCGTACAGGTCGTCGTCGCCCGCTCCCCTGCCGCTCATGCTGCCTGGCCCGGTCCTTGTGCTGTGACCTCGCCC
CACCGAGCCGCTCGCCACTTGAATGTTGCATCAATCAAAATGATCTATGTGACATTCGTACTTAGTCGGATGAAAGCGCGCCAAACCTTGACGCTCTCCA
CATCAACTCATCAGATGGACGCGAGGTGCGGCAAGTACTGGGAGGACGGCCAGGCGCTCGTGGCGGCGGCGGCAGCGGACGCCTCGCGGCTCGCGCAGAC
GCAGGGCAAGGTGCTCAAGGAGCTGCGCACCATGAGCCGCTTCCTGCAAAAGAACCAGGCCGCGCGCTTCAGCGACAACGCGCAGCAGAAGCTCGTCGAC
TGCGTGGGCCACTACGTGGCGTTCTGCAAGCCGCTGCGAGCCGAAGCAGGCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGCTGTGTTCCA
GGTCGTGAAGGACGGTCTAGCGATGCCCTTCAACGTCATGGGCACCAAACAGAAGAAGCGGCTGCTGAAATGGTACAACGAGCTCATCGCGATCGTCGGC
GGCGACCCCGACGCAGACCAAATGCTGATCGACGGCCTTGAGGTTCCTGCGCCAGCGGAGCGGGTCGAGTGGAGCGTCTTGGGCATCGACGACGAAGGGT
ATTTATCGCTCATACACGCGGAGAGCGGCGAGACTAGCGAGAGCTTCCAGGTCAAGCGGAAGAGCAAGGAGTTCCGCCAGATCCAAAAGGCACTCGAAGA
ACACGAGGTGACCGTCGTGACGGTCGGTGACGACGTGGCCGAGATCCACGTCGAGGAGGAATAGATCGACTGCTCGGTTGTAACACTACCAATTGGACGA
GCAGGTGGAACCAAGCACATTATAATCGAAAATGGTTCTGGGCCAATCTTTCCGAGTATGCACGTTGACGCGGCTCAAAAACCAGCGGCTGGGGTCTTGT
CGCGACTCTCGGTCCATGCCTTGGCGATCGTCCGCTTCATTTCGTCGTCGCCTTGGTCGTACATGTTCTGTCGACGTCATAAGATCAGGATGCGTCAGAG
CAGATGCAGCCGAAACATCGGTGGTAACAATGAACGCAGGTACCTTCATCATCTCCATGATGCCTGCGGACGGGTCGGACGGGCTAGGCTTGGCAGCCTT
GCCCGGGTTCTTGGCCGTCAGGTCCATCCACGTGTTGTCCTTGTCCTGTTTCCACAGCGAGATGGTCACACGGTTCTTCTTGACGCGGAACGAGCTCTTC
TCGGGCACGATCTCCTTCTCCAGATTGGGCTTGACCAGTCTGTACAGCGACAACACAATGTGAGCACCAACTCCATCACGATGCACAACAGGAGAGACTG
CTTCCTCACCGGAAGTTCTTGCCATTCAGTCCCAAAATCTGCACCAAGTCAAACAACATACCAAAAGGTCAGATGTGAGTCTTGCCGACACTCCACAAAG
CAGCATCCACGGCGCACCTTCAGGTCGAAGGACGTCTTGGTGAAGCTGCACGTGATATTCTGCTCGGGCAGGCTCCCGACGCCGTCCACGCCCGACATGA
CAAACACCAACACCTTGCTCTTGCCGTATCCTGCACCAACTCCAGGTCAGCTTTCACCGGATTGCCTTTCGTAGCAGCTCCGACCTACCATCGTCTTCCC
AGCCGAAGCGCGAGATCTCCGTGAACGTCGTCGAAGTGGGAGCTGCCGCAGGAGTCGCGACTTTCACCGGCTGCGGGGTCGGCACTGGTGCATTCGCAGC
CGGCGCCGCGTCCACTTCCATCGGCTCGCTGGTGCTCTGCGCGTCCAGCGCGAGCTGCTTCTGGCGCAGCAGCGCCGTCAGGTCGCGCACATTCCCGGCC
GTCTTGACCTGCTCGAGAAGCGCCTGCAGCTCGGCGACCTCGTCCGCGAGCGTGCTGTCGTTGCCTGCCAT