Description :
From Genome Similarity Track
Location :
Scaffold_270:108- 1705
Transcript NameFunction/comments
Phyag_g4141conserved hypothetical protein

Sequence
1597 bases(100 bases per row)
TCAACTAACATTAAGCTTTGCGTTGAGCTGCAAGTTCCCACCCTGACTGGATCGTGGAATCCAAAGCATCAAAGATCCACCTCCTGTACCTGGAATTCCC
AGGAAACCATCTCGCCATCGATCCAAGTACATTGTTCTGCCTCCTATCACCGAAATGTTGGAGCGCCAAGTCACTTTGGCGCCCGTTTTGATGTATACCT
GGTCAATCCGGTCGCCCCCCGACATGATATTCACTTTCACGTCCTCCATGTCCGTGCTCTTGAAAGTTACAGCGACACCACCATCGCCGGTCTTGGTCCA
GGACCCGGAGCTGCCATTAAAAGCTTTCCCTATCGTAGTCAATCCCAACGCGTCTGACGCAGAACCATCGTCTACTTCGCCAATGAATTCTGTGGGCCCA
CAAATGGTCTGAAAAAACTCCGATGCCACGCCAAGTACGTTTGTCGGATCCCAAACTGCAGTGAACAGCAGAGCCTTGTCCGTAATTGTGTACGCGTATT
CTTCTGCAGTGAGATACGTGCCGTTTTTGCTCGTTCCGGAGCTGATGAGGTCGTCTACGATACCCCCAAATGTCTTTCGGAGAAGGTCTCGTGTGGTGTA
TGCACTGTTCTTGTCGGATTCGTTGATCAACTGCTCCATGCAGTTGTTCGTGACTATGGGGACGTCGTGATGCATCAAGTTCGACTTGCTCAATATCACA
CGAATCTCATCTTCCGAAATTCTCGGGTTTTCTTTGCGTAGATAAACCACAGTGAGCCACACGCGATCGGTAAGACGCTTCATCTCATCCCCACAGGTCG
AATTTGACTCCAACgccgactgcagcgacgtaATGTCTATCTCGtcgagatcgtcgaggaTGTCATCTAGCGAGATATTCGCCATAAAACTCTTGAACGT
CGCCCAACTGGACAAGATGGCGGTCTGGTACGTTACGACTTCTTTCACAAACAACTGGACGGTGTTGGTCACCCGATCTGCAAATTTTAGTCCTTTCTCG
ACTTTGATTCCGAGGCACGACATGATCGTGATCGGCACGTCGAAGACTACGTTGTCAGTCTGGTACAGAATGGCCGTTAGTTCTTCGTTTGTGGTCTGCG
GGTCGGTCACCATGACATTCCTCGAGTACTTCGATAGCGCTCTCACCAAATTTGCCACCTCTTTGCCACATTTGATAGCAATCTGGACGCCTTTCGCAAC
CTTCTCGAAGGCGCCGTAAACTCCAAACGTAGAGAGGGAGAGAGTCGCTCGAGCGACAGTCGACACTTTCGACACCATTTCCAGCGTACAGTCGTCATTT
TGTCGGATGCACTGCATTCCACACTCGACGGGATATTCCAGGGGACATTCGGCCCAACACGTACCGAGTTTGTAGTCGAATCCAAGAGGGCAGACTTTAG
CGATATGGGTTTCACGATAGCACGCTGTATCTACCCCAGCACTTAGAGCTGGCCCGACCCAGTTGATGTACGTCGACTCTAGTGTGCTGATGTTGGCTTT
TAAGGTCATGTCCATTAGACCCCAAGCTAAAGACTCAGATAAATCGccatcctcctcgtcgtcatcactgtcgtcttcatcatcgctttcgagttcg