Description :
From Genome Similarity Track
Location :
Scaffold_9:1079984- 1083626
Transcript NameFunction/comments
Physo_525039acetyltransferase
Physo_461827Avh21

Sequence
3642 bases(100 bases per row)
TTGTGCTTTGCAGTTATTTAGCCGACGATTTTAGACGCTAAATATGACAAAGCCTGCTCCTAAATATTTGTGAAAGAAGATACACGACCTGCTAAAATTA
TGCATAAATCCACCTCCTCATATATTTATCGACTTGGGAGGGCCTGTCAGCAGCCATGCATTGGCCCAGTAGACCACCGTCCATGATCCCCAGCTCATCC
ACCCTCTTATGCATAATTGCCGTGTGTGTAGGTGCTTGTGGATAAAACCCGACAGAATTGCAGCTGCACAGCCACAATTGCACTTTCAAAAGTGCAATTG
TGGCACTTTTAGCGTAATTCTAGGCCTCCACCCATTTATGCACCTCGATTTATCGTATATCTAGCAGGTGGTTGCTATAAATACAGCAAATCTCGCCTCA
TATTGCCAAAATCATTGAATGAATAAATGATGTACGTGTTCGCGTAGCCATATTACACCTGCGCTAGGCTCAACTTAGCTAGTCGGCGGCATAGTGTGGT
GTCCGCATACGTCGAGTCACCAGTAGCTGACAGCGAGTCAGCAATTCCAGCCATCAGAATCTTCCATTTCAGTCTGTCACCAGCAAGTGTGCGGAGTCCC
TCGAGATCTTGCGCGTTCCGAAGTCGGTAGCCTTGGCCACTGGCTACGAGGTCAGCGTCAAGTACGACAGGAAGGGTTGTGCGGGGGCGACCGCGCCATT
GGTCTGCTTCGCTGGGGGCGTAGTAGGCAGCCATTTGTGTGTAGGCACGGATGTCCGGCCGTCGGAGAATGTGTCCAAAGAGTCCCCATCGGGCTGCCAC
GACTCGGTGGCGACAAAATCATTGCAAAGCACAATATTGTGCCTTTCACTTATTCTGCCGTGATAATTATGGCAAACTCTAATCCCTCATTGACCTTAAT
TATGCCCCGAGTTAGCTAATTCCCATGTTAATTCCGGGTCGTCTATTCGTGGCCGAATTAGGAGCGGCGATGGCGAGGCCGAGTTAAGGCGGAATAAGCT
AATCCAGTCTGCTTTTGGCGGAAACAGAGCAATTGGCGGTTTCCTACCCGCCAATCATGCCACCCTGCTCGTATTGGCTCTCGAATGCTGATCGCGGAGG
TTCGGGGAAGCACTGACAATCTTAGGCAGAATTAGCACTAAATAAGCGTTGATCGCCCTTTTATGACTCTAATTCCGCCTGAATTAACAGCTCACCCGCC
AAAATACGTGAAAGGCACAATATTGTGCTTTGCAATGGTTTTGGCAATATGAGGCGAGATTTGCTGTATTTATAGCAACCACCTGCTAGATATACGATAA
ATCGAGGTGCATAAATGGGTGGAGGCCTAGAATTACGCTAAAAGTGCCACAATTGCACTTTTGAAAGTGCAATTGTGGCTGTGCAGCTGCAATTCTGTCG
GGTTTTATCCACAAGCACCTACACACACGGCAATTATGCATAAGAGGGTGGATGAGCTGGGGATCATGGACGGTGGTCTACTGGGCCAATGCATGGCTGC
TGACAGGCCCTCCCAAGTCGATAAATATATGAGGAGGTGGATTTATGCATAATTTTAGCAGGTCGTGTATCTTCTTTCACAAATATTTAGGAGCAGGCTT
TGTCATATTTAGCGTCTAAAATCGTCGGCTAAATAACTGCAAAGCACAATAGTATATATATATATATATATACGATCACATGTAGTACGGAACTCACATG
AGTTTTACTACTGTACGCTCCATAGAACCTCCTCAAATATATATGTCACCTGTTCAATCCGATATTTTTTTGCCCTTGTTATATGATAATTCAATATAAA
TTTCAATATAAATTGCGGCAATTTTTATTAGTGCTTATCGTAAAATTGCAGTTTTTATTTGTGGCCAATGTTGACCCCAATTCAATATCATACTGTATTG
GCGGACCTCTGCTGCAAACGGAACGGGGGTATGGTCTTTGAGTGGGTGGGCACGACGGCGCCAGGAAAACCCTGCATAATGGCTGGGGACACAGGAGGAT
GCTGGCATCGGCTTGCTGTTCAACGAACACGGCGGCGCTAAAGTCGCTTTTCTACTTACTGACCAGAGCATCGAAGCTAAATTTGCGCGGGATTAACGTG
GCCGGAGACGCAATGGTGGTGATCCGATACCTTCGCGACAGACGGAGAATTTTAAAACCTGGTACCTTCAGCGCCGACGGCTAGCAGATCGGATTCGGGT
AGATGCCTGACATCATATCTACCCGAGCTCTAATACAGGATGTGTGCTACTCGCTTCGGACGGACCGACAGTAGTCGATTGTTTGACCAGCAGCTTACCC
TCACTGGAGCAAGCTATACGACAATACATCTCTAATATAGATGTATTATTATTATGCTCTCGCGCGGACAACTGGAAGCGGGTAGCCATTGTGGCAGCCG
AAGGCAGAACTAGATAATGCCAAGTTGCTGGTCTTTTGACTGGCTAGGTTGCTAGGATTCTTTTAAGCAATTCCATATACCTCATCCTCATGGAAAGCAC
TCAGCTGGGCACCAACTGCAAGGATCAGTACCTATATAATCCACAACAGACTGTACCAAGCAACACTACAAAACTCGGGAGCAAAAGCAACGATTTTATT
CTTTTCCCACTCGAGTTTATTCCCCACCCAACTCGTGTGTTTGGTCTCGTAGCGTGATTCTAGCATTTAGTGGGGACACCGATTCGCGGTGATGCACGTG
TCAGTGGCCATACCCGACATGTGCCGTCGCAAAGCAACTAGAAAATGCCGTGTTTGGCCTTCAGAGCCTGCAATTGGAGCCAAGCGTTGTGGTCGCCTGC
TTCCTTCAGAGCATTTTCGATTTTTTCGATATGCTTCTTAGCCTTGGCTGGATTGAACTTCGCGAACAACTGCTTGATGGAAAACCCTCGATGTCTTCGT
ACTTCTCGACACGACGAAGCATTCGTCCGCCATTCCCGTCGATTAAATCGGTGGCAGCAGGAGACGCATCGTACTTGATCACAGTGTTGGGATCCTTGGC
CGAAAAAATTGACGCACCACTGGCGTGGACAGTCACCGCAATGAGCAGCGCGAACATGAAAGCGAGGCGCATACTGACAGTTGGGTCTTGAGAACGCAGC
GGAGAAAGTAGGTCGAGGGAGTGTTTGGTTTTTGCTTGTGGGGTTGCAGAGCAAATTGCGGAATGAAGTGTGCGAGAGCTTCTGTTTTGCGGAGCTTGGA
CGTCAGGCAGGGCGTGTATCGCGTACGCACGTACGCACACAGTGGACTACATGGAACGGTGGGCTACATACGATAGATAAATATTGCGGTCGCTCGCGAA
GATGCTTTGTCCATGCCAGTAGTGATATTCAGATCCTAATAACGTTTTGCTTATGCAGGTATTATATATGATTGCGGTATTGTTTCGTGCGAATCGCCAT
TTGTACGAGGATTAAAATATACACATTTGGAATATACAAAATGTTAACATTATACTGATACCAAGGCCAAACACTAGTTTTGTGCGAGCTTTTTGTCAAG
CTGCTGTGTGTAGGACCATAGCTACGCATCATACTAGGTGTGAACTAATTGATGTTATAAGCGTGCAATATGTGAGCAACGACCGGGTAGTCAATGCGGT
ATTTCGAATGTAAAATAGCAGCGGCCAATGCTACCACAAAAT