Description :
From Genome Similarity Track
Location :
Scaffold_110:107989- 111880
Sequence
3891 bases(100 bases per row)
TGCTGATCAAGATATGACATTCCCTTCCGGCTAAGAATTGAACACCAGTTTTTGATGTATCCGTGATTGCTCTAATCCATACAACTTCTTCGTATTTGAA
CCTCAGTCCCAAAAATGGAATTTCTAGTCTTCACCTATTTCGGGATATTCCAGGCGATGTACAAGCTTGAATGTTTTTGTCTAAATGCAAACGATGCCAC
AAGTTATCTCCCGAATATCATAACAAGACACATCCGGAGAATGGGCAATCGGAATACCGTACGTACGGTTGTTTAAACTTAATGATTTATTTGCAAGATT
CCGACACTAAGATAAGTTCACAGAATTAAATTTGATGGCTGCAGAAAAAGCTATAAGTGTCATTTCCTGGATCCCAATAAAGTACGGATAGCGTATACGT
ACCATTCCCTTCTGTTAGATGCGCCACAGCCAACCATAAATCAAATAGATTTCTCAAGACTTTTGTATTGTAACGACGTCTGTTTACACAAAATCTCGTA
GTGGGGCCAGTCTTCCTGCATGGAAAACACCGGCGTATTATATTAATATGAAAAGATCCACAAAAAACCAATGACTCCAACAAGTCCACTACATCATGCC
GCTAGCTTTACTGGCTGTAGCGACATTTCCCTAGCTTGTTATACCATGAAAGTACCTACTGCTTAAGATCCATCGGGAGAATATATGTCTAATGCGAAAG
GCCGCGCACCATTTAGAACAGTTAGTGTGGACTTATCAAGCATGTTGTCTTTCATGGAGGAAGACACAGAGCACTTTTTGTTCACATACCTGTTGCAAAA
GACATCACTTTATCGTGATCTTAAGGTGGTATATGTGTGGCCGTTTAAAGGTCAAAACTAATCATTTTGAAGGAACGTTCATGCGTACACCTTCATCAAT
GTGCAAAATAATGCATTACTCTCTTGTCTCTTTGATATTATGTCAGAAAACAGAGAAATGCGACCTCAATAGAATTATTGATTGGAAATGGGCATCGTTG
TACGTACCAGTCCCTTGTGGTCTATCTGCGAAGTGGGATATGTTTATATAGTAGAAGGGTGTGATACGTATAACAGTAAACATAGGTGTATGATCCTAAC
GCTTTAGGACAGTTTAGACGCGTCGAAAACTGAGCCTCCGAGATACGCGCGCGTGTACATTTCTTCTTTGTTTATGCAAACTTCCAGGATGCGAAATAAT
ACCTACGTATTGGGGTTAAATTTTCTCTCTTCGATCAATGCGATTTAATGGAGCTTTCCCAATAGGACACCATAAAAAAATTACTGTCGAGTGTATAAAC
ATGATCAAGCTCGTTTGAATGAAGTATACATTCAATATTCTCAGTCAAAGTGGTCGAGGCAATGCTACAGTCAGGTATGCTGTGTTGAAGTCTTCGTCTT
TTTGTCGAAGATGATGCGACTTATGCATACGTGCATGTATAGGTAAATATGTATGCGTGTGTATTTAGGTGTGATATGAAGAAAGGTGGTCCACAACAGT
GAAGAAAGGGGATGCGAAAGTGATCAGAGATGTAAGGGGTCAGACAGTGATCAAAGATTGGTCAATCGGTCAATCTCAATATAAATGCATGGTTAACGGC
AGAGAGAAGGATATGAATGGTCAGCAAGAGAGAGAACCGTAAGCGATAAGAATGAGATTATCACACAATATCCAATTCACTTTTGGTATTCCTGCTTCAG
CCACAAGTGCCATCTTCGCTTTGGATGATCAAGATCTCCAACAGGTTATGAGCCTAACGACCGATTCCGCACCCAAGTTTTAATAAACAAATTACACGAT
CTGGTCGTTTAAGATCAAGATGTACATCATGTCCAAAAGACTATGGGAAGCTGTAAATAGAGATAGTGGCGTCACACAGGCAACAGAACTGAAAGTACAA
GTGTCCATCGTGCTAAACTGGACGAATCGCAGCTTGCACGTGGTCGGAACGGCTAATGCGCCCGAACCCTGGACAGAGTTGGCGTGAGCCTATCGGACAC
GTGACATAGCAAGCCGACTGTCTCTAAAAGAGAAGAGGCGTCTTGCAATCACACAGCGAAGGATATGAACACACACGTCATGGAGATCGAGTGGCCAGTA
CAAGGATGACCGGGGCTGAGTGCGGTCCAAGTGAAGAAGATGTGTGTGCGACGATGCTACGTAGTCTACCAGTATCATACGAAAGCTTACTTCAAGTATT
CTGAATGAGAGTTACACAGTGCTTCTGGAAATATCTCGCGAAACAAGCTTATTGCCGAAAAGGTGCACAAAAGAGATTTATCTCGGATTGAAGAAGAGAC
AGAACTACATGAGAACACACGTCAACGCCAAGCCAAGATCAAGTTCGGAAAGAAAAGCATCGGCCAGCACAAGAAAGGATCGAGTGTTCAGTGCTACAAG
TCTGGGAAGCACGGGCACTACGCATGAGACTGTTGGTCGAAGGTAAATGGTGGTGGCGAAATGCCCGATGACCGTAGCGACCATACGAATGTGGCTTTTA
ATGTCACTGAAGGAAGCGCAAGCGACTGCTATATTTTCACAGCGGCGCAACGGCACATATGTGTAAGGATCTGGAAGCGTTCGTCGACTACAAGGAGTCA
TAAACTTCCCGCGATGTGCAAAGCGCAAAGAGCAGCATTAGTTTGAAAGTGCTCGGACAAGGAACAGTGATCCTGCAGGATTGGAACGGTACGATATGGA
TAAACGCGCACCTCAATAATGCGCTTCACGTGCAATGCCAAAACAATAATCTATTATCTACAGCGGCAACAACGCGCGGGATGAAAATTGATATATTTGA
AGACGGATGCTTTGTCAAGAAAAGCGGACATATCGTCGCGACGGGATCGCGACGTGGTATGCTTCTGCAATTGAATATGAAGGCAGCCGACGAGCTCCAT
ATGGTTGAGCAGGAAGCACAGCGTTGGTATCGACGACTTGGGTATGTGTCGGACTAGACCATAAACATGCTGATTGAGAATGGGTGCATCGCGGGTGATT
GCATCGAACCGAAAGTCGTATGTGACATATGTGCGACGGGCAAGCAAGTACGAAGACTTTTAGCAGCAGTCGGGAGGAGATATAAGCAAGAGAGAGTCGC
CGTGACGACTTAGTTGTGTGCTCTGATGTTCTCGGTCCAGTAACACCGGCATCTAAATCGGGCTACCGCTATGTCGTGGCTTTCATGCTGATGAAGAACC
GTTACGCAATGATCTTTCCGATGCGAAAGAAGAGCGAAGACGCTCAAGATCTCAAGAAGTACTATCACGATATAAAGCTCGAGTGTGGAGTTGATATTAA
AGTACTTCGAAGCGATAATGGTGGCGAGTAACAAGAACTTTCGATGAACAGATTCTACCGGAACAAGTTAGTTAGAAAGAGTATACAGTACCTTATACCC
CAGGTCATAACGGCGTGGCAGAGAGGTTTTACCGCACACGGTTAAGATGATTCGTTGCATGCTGGGCAAAGGTAAAATGAATAAGATCTATTGTTGCGAG
GCAATGATGACTGCCGTGGATATACGTAACGTGCTACCAAGTGCTTTAAGTCCTCAGGTCAGCCCATTCGAGAATGTATTCCATAGTAAACTTGACATCA
ATACCATGCGGGTGTTTGGTAGTTTGTGCTACGCCCACATCGCTATGAAAAAGGGGAGGAAGCTTGAAGATTCCGTTTTGCGCTGCACATTGCTCCGTTA
CGCTAAGCAGAACAAGGTGTATCGACTGCTCGATATCACTACAGGGTATTGTCCACTCACGCAGCGTGACATTCGCCGAGCACGGTGCAGAATGACAAGA
ATGAGTAAGTGATGGAATGCCAGGTGTGCTCAACGTTGTGGAGGATGAAGAAGAGGATCATGAGCCGAGAGATACATCAATAAATGATGGA