Description :
From Genome Similarity Track
Location :
contig_81:10798- 13007
Transcript NameFunction/comments
g10343.t1PREDICTED: copia proteinlike putative
g10344.t1hypothetical protein

Sequence
2209 bases(100 bases per row)
GGACTTCGCATTGAGGGGGCGTATTGAGGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAA
CCCACGCCGATTACGCCACCGACGATTACGCCACTGTCGATTACGCCACCTGTGGGTACAAGATTGTAGGTACAAGATGGGCTTCGACGTGGCGCTCTCT
CATTGGCTGAAGTAACTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAA
TCACTTTCGAATCTTCGTTCTACCCTCAAGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCCAGAGTGCTGCCTCCCTCCGCTCCGTCAAGCTTCACGGTGT
CCAAGATCCATACCTTCCATCAGCCTTGAGCGAGTTGGTCGCGAAACTCACGAGCTCCGTCGTGTCGCACAAACTTGACCTTCTTGCCGAACTGCGTCTG
CACCTTCGTGACGTACGTCTTGATGCAGTCTTCGCTCTCCGACTTGGCACGCAGGCAGAACCCCTTCATGCATCCGCTGGCTTCGTCCACGATCAGCAGC
AGATACTTGCTGCCACCCAGTGACTCTTCTTCCATGGGGCCGCAGATGTCGAAGTGGAGCAGCTCGAACGTGTCGTAGCGACGCTTGTCCCGGTTGCTTG
GGAACGGCTTCTGGACCATTTTCCCTTGCTGACAGCCGCGACACACGCTTGGTCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGTCGTTGTC
GACCATCTTGCGAAGCACCTCCACCGGAGCGTGACCCATACGCGCGTGCAGGTCGATCGTCTTCCCACTGGTCGCCGCATTCGCCGCTCGCTGAGGCGTC
TGGAGCCAGTAGAGGCCATCCACGAGGTTCGCCGCCGCCACCACTTGCTTGGAGGCCTTGTGCGCAACGCGCATCTGGGCGCCATCGAACACGACTTGGA
ACAGACCACTCTTGTTGATCTGTGGCACGGAGAGCAGATTCTTGCTCATGCTCGGCACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGTCGCCGTT
GGGCAGAACCACTCGTTCCACGATGGTTCCCACACCCATGATGGCCGCCTTGTTGCCGTCGGCCACCGAAAGTTCGCCCTCGTTTCGCTCAATCAAATGG
GCGAACTTAGCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCTGTCGACCGCCCACATGCCGAGCATATCCTTGCCCGTCGAAATGCCACACTCCAGTG
AGACCGCGAACGCCACTCGATCATAGCCGTAGCCGTAGTCGTAGCTGGCGTCGTCGTTCCTCCACTGGGCATTGTTGGCCCCGCGTCCACGGCCATTGCC
ATTGCCGCCGCGTCTTGGGCCCCGATTCTCGTCCTTCTGCTTGGTCCAGCACTTGTCGATCGTGTGCCCCAATTTCCCGCAGTACGTGCACTGGCGAGAC
TCTCGGTCGGTGTTGAACGCCTTGGCCGCGTCCTCCGTCTTCACCGTCGCCGTCTTCTCGCCTTGCCGCTTGATGTGCTCATTCGTCAGCACCTTCACGA
CGTCTTGCGATCGCAGCTCAGCGCTGCTCATCTCCAAGTTCAGCACGACGTTCTCGTAGCTCTTGGGAGACTGCGCAACAGGCAGATCGCCACGTCCTCG
TCCTCATCTTGGCGCCGATGCTGCTGAGCTTGGCGCTGATGTTGAGGACCTCGTTGCAGTGATGCAACACGTTCCGCCTTCCGACATCTCCATGCTGAAG
AGTTGGCGCTTCAGGTAGATGCGACCAGCCTTCTGCGAACCACCGTACAGCGTCTTCAGGCGCGTCCACGCAACCCACGCTTCTCGCAGTCGTCGACCAC
ATGTGGTAGTCCGCGTCCATGTGGAGCAACATCAGTCCGAACGCGATGTTGCTCGACTTGACGTACTCGTCCTTGGGCCGCGAGTCCGTGAAGCTCGGCG
TCGTCTCTCGGTTCACGACATGCCACACCGACTTGGTCAGGAACACGCCACGCATGTAGCGGTTCCACGTCGCGTAGTTGTCTCCGTTGAACTTGTCGAT
GGAGACCTTGGGGGGCGTCGTGGGCAGAGGACATGGTGCTTGGGCTCATAACCTGATGGAAGGTATGGATCTTGGACACCGTGAAGCTTGACGGAGCGGA
GGGAGGGCA