Description :
From Genome Similarity Track
Location :
Scaffold_427:10798- 12710
Transcript NameFunction/comments
Phyag_g5623myosin-like protein

Sequence
1912 bases(100 bases per row)
CTACACGTACGTGGGGCCCAtcctcatcgccatcaacCCGTACCAGCAGCTGGATGCCGCCtacagcgagaagaagatgacggaaTACTATGGGAAAGCC
ATGGGGATGCTGCCCCCGCACGTGTTCGCACTGGCCGACCACGCCTACACGCAGCTCATCCAGGGGGGCGCGCTCGATCCGGCCAATCAGAGCATTATTA
TCAGCGGAGAGAGCGGCTCGGGCAAGACGGAGACCACCAAGATCATCATGCAGTACTTGGCACGAGCTACGAGTTACCGTAAAGGACCGGAGGGGGAGGG
AGTCCCTCCCGTAGTGGAGACGGCCAATAGCGGCATGTCTGGAGCgttgggcaagctggagGAACGGGTGTTGGagagcaacccgctgctggAATCCTTT
GGTAAtgccaagacgctgcgtaATGACAACTCGAGTCGGTTCGGCAAGTTTATCGAGATCCAGTTCAACCACCACGGCAAAATTGTGGGCGCGCAGATCT
TGAACTTTTTactggagaagacgcgcaTTGTGTCGCAAAGTTTGGGGGAGAGGAATTACCATATCTTCTACCAGTTGTTGGCTGGAGCGGACAATGCACT
GAGGGAACGACTGCAACTCAAGACGCCGCATGATTACGAGTACTTGAGGAAGAGCGAGTGTTTTCATATCCATTCGTGCGATGACGCCAAGGAGTTTGCG
ACGACCAAGAGGTGTATGGAGACCATTGGCATTACGGAGGATCGACAGGAGATGGTGTTTGAACTCttggcggcggtgctgcagctcggcaaCCTGCAGT
TTGCTATGGAGAATGAAACGTGTGTGTTGGTAGGGGATGATTCCGCGAATGGGCTGAAACTCGTGGCGTCGTTGCTGAAGGTTAGTGAGGATGCATTGtc
caaggcgctgctgacgaggCAGCTGTATGTCGGCGGCAAGGTtatcgtgcagcagcagaactcGGAGCAGGTGCGCGACAAGCGAGATGCATTGGCGAAG
GGTATTTACTCGTCGCTGTTCTTGTGGCTTGTGTCGGAGTTGAACCGCACGATCTCGCGCAACCAGAACAAGTGGGGCTTCATTGGTGTGCTGGATATCT
ACGGATTCGAGAAGTTCGAGTGGAACACGTTCGAGCAGTTGTGCATTAACTACGCcaacgagaagctccagcgacacTTCAACCAGCACATGctcgaggt
ggagcagaatGACTATGCGAAGGAGGGGATCGACTGGAAGCACATTGATTTCGAGGACAACCAGGAGTGTCTGGATCTGATTGAGAGCAAGGTGAACGGC
AAGCCGGGTatcttcatctcgttggATGACAACTGGCGACTCAAGGGCGAAGAGGCGAACAAGAAGTTTGTATCGAATCTGCACAACTCCTTTGGCCGCA
CGTCTAGCGGAcactcgagcagcaagaacaagttCTACGTGCACCCCAAGATGGACGCGGACTTGCACTTCGGCATTAAGCACTACGCCGGCGAAGTGAT
CTACGATGCGAGTGGCTTCAACGACAAAAACAACGAGACGTTGAACGATGACATGAAGGAGCTCATTCGGCAATCCAAGAGCGACTGGCTGCGGGGGATC
TTTGATCTTAATATGCAGTCGATTGAGGCCATTCCTGGCAAcaaaacgcagcagcagcactcgattTCTCGGCGTCCCAACGAGATGAAGGGCAAGGGTC
AACAGGGAGGCAAATCGCGAAACATTCGTGAAGTTTCTGTTAGTGCGCAATTCCGGTatcagctgcaggaacttATGAACAAGATTTCTCTGGCGAACCC
TCGGTATGTGCGTTGCATTAAGCCAAACGAATTCAAGCGTCCAAGCGAGCTCAACGATACAGACTGCGCGCGTCAGCTGAAATACTCCGGTATGATGGAG
GCGATCCAGATC