Description :
From Genome Similarity Track
Location :
Scaffold_179:10795- 15989
Sequence
5194 bases(100 bases per row)
CCAGTAGCTTCCGGCATAAGACGAGAAAGATCGGTATTTCTATTTGTTTGATTTAACGAGTCCGATGTGGATGACGACAAGACAATCGCCTAATACGCAA
GCGCGGACAAGTAAATCTTTTTTTTATTAAAGGGCGTGCATTTAACAAAAATTGTTCATTGTTTTCATAAGGCGTCCATTTAGTAATTTTGTAACAATCC
CCTATATATATTTACACGTATGTATTTATAATTTTAAGGTAAAGCACCTGGCAAAAAGATGACAGACACATCGTAAATTGAAATACAAATTCACTGAAAA
AGTGTGGTTGCTTAAACATGTTCCAAGCGCGGCCTGGCCAAGTACAACTCATGAAAAAGGACACACTTTAAAAGAAACGCGTAGTCCAACACATCCAACA
CGATGATAGGAAGGTAGTAAATTTCGCGAAGGTAAATGCCAACTGGTCGCTGTAAATTTTATGTTTGATGAAGCCATGCTAATTATCTTCAGGCACTGCA
CTAACACCATCATATTGTTTACATAACATGTACCAAACCAGAACATAGAACGCTCTAATGTCTAATGGCCATGATCAAAAGTAGATTCATCAGGAAATGA
ATCTGCTTAATTGCATAGTAATTTGAATTCATAGTTTGAATACCATGTTGACGCGAGATACCAACGCAAGCATGTGCACGCTGACCGATTGCGACGTCGT
TAGCAACCCCACAGGTATCCAGAGCTCGCGCCATTTTGTTCGTAGCACGCAAAAGTGACACCACCTCATCTTTCCGAATGCGTGGTACACGAAAGCACAC
CACTGCCTCGAATTTGGTGCAAGCATATTCTATTGCGTATTTCGATGTTTATAATGCAACATCGTGGCTACGGCCATCTTTTTAATAAAAACAGTGCAGT
TTTACCTAAACCAAATGTGATATTTTACTTTCCTTATGCATTAAGTTATAATTTTTGTCAAATGATTAATTTAGACTGTTGGACTGGGTGTGTACGTATC
AAAGGTTGGGTGTGTACCTATCATTCTACTACAACACCAAATAATTCGCGATGAAATTAGAGATGTCAAAATAAATTATGTTCCAAGGTTGATATAATGG
GTGATGGAATCACATAATCTAGTGTTTGGGGTGGCATTAATCACGTAAATATTATTTTTGAACTGTCAAACGATATAAATGCATTCGAAATCTGGAATAC
CATCTGTAAAGACAAGACAGATCTCAGCAGATTTCGCCGGGAGGGCAAATTCCGCGAACCTGGACGCCGTGATCAACACAAGGATGGACGCTTTTTGTCC
TAGCACCAGATCGGACGTCGACATGTCAAGCAGCCACTTGAGGGTTGTATTTCGTAGCTCTCTCTTGGATCATAATACGTATATGTATATCGTTGTACTA
TTATGTTTACTATACCACTATAACCGCCTCTTGTGAAATGAAGTCGAGTGCCAAACCGTTCTTTTGTGTCTCGAATAATAGAATTTTTTATAAATTTAAG
GGTATATGTTGTTTCTATTATCAAGGAGCTTAGTTATGATGCGAGAAAGGACACTTAGTTAATGCTATGTGTGTACAGGAAGTATTTTGCACGGTCAAAA
CGGGCTTCCTCGAATTTCTTACGTCATTATCGATTCCAAGTTGTTTAAATTTAGCCTCGGATCCTGAAGGGTGCTCGTGGAAGAGCTGTTCGTCGTGCGC
GTAGATGCATTTGAACAGTGCTTTTCGCTCGTCGTTGAGACAATTGACGCAGAATTCAAGATTTAGCATATTGAGGAGGGATTATCTGCACCAAGCAGCG
AAAACCTTCTGCAAACCATGTATCGATGATTATCTGTCACTGTACTATAATATTTGTTCGTTCAGGTCAAATAATATAATATACTACGAGCATAAAATGA
CTCCTTTCGACGTTTGTTCCTGTCATATGAAAGTAAGAAGGTAATTGAGCCGCAGATTTATACCAATATGTCGATTCTTTTGAGAGGCGTCTCATCATTA
GCAAATTGAGATTACAAGTATGATGTGTCTGTAAATAATTCGACAATCTACAAATTGTCAGATTTTGGCTTGGATTCACAATTATTACTAATTCTGTCCT
GACATGCTCATAGTATAATTATCGGTAGGTACTTTAATACTTGGCAAATGCTAAACGGTTGGGTTCATTTTTGTTTGGCTGGGTCATTTTTGTATGTTTC
TTAGGGATAGTTCAGAAGTACGTCTAATTTAGTCAGGAATAGTCCCAAGTATATTCAATTTGGTTTTAAAACTTACTTAATTGTCAGTGTAAAGCCCAAA
ACTACGACATTAGTGCAGTTCAAGGCCAAGGTCCTTCGCTTATCCATATTCCTTTAAGTTGGCGCTCTCTTCCGAGAAAAATATCGTTTTTTGACGCCAT
ATCGGGCGATCATTCATCTTAACAGCAAGACTCCTATTCAACTACATCCATCAAAGCATGATGCATCAGCGCAATCGCGATAGCTCATAAGGGGCGTTAA
TTCATGCCTAAGATCGTAAGTGGCGCCCTCTTATAAAAAATTCAACCACAATAACGAAGGGCAACTTTTCATAACGCTGGAATCAGCGCAGTCGGCTTTA
CAATCGAAAATTCGCGATGTAAAATTAGACGTGGACGTTAGTGGTCGCACTTGAGTCGCGAATATGTGAACTTTGGCATTTTAGATCCCGCAGAGAGATT
TAGATAGCGCCGAGAGTTGGTGTGAGGGCTAGAACACCAAAAATACCCAACAAGATGTAACCGTACATCGTGGGTGGAACGCGGAGCTATCTTGCGAAGA
AACATTTGGCTATTCAGTCACTAAAAGTCACTTCGTTGGGGGGGGAACTAGTCATATGAAGATACAACAATATGATTTTAAAACGACGGTTCATGTTACG
TTATACCTAAGAATGATGAACCCAGCCGTCTAGCATGTGCCAAATATTTAGGGGGTTAATATAATAATATCCATTTTCCTTAAATTCACACCCTTCCCGT
CAAACCTGATATTCGAATCCTTTTGCCAAACCCCAGTAAATACACCCCTTTTCCTTAAATTCACACCATGCTTGTCAAGCCTGATATTCGCACCCTTTTG
GCAACCCCCAGTTATTAAACCCCTTTTCCTCATACTGTTTATTTATGTATAACAATCGGAAATGGTTATATACTACTTTTCATACCTTCAGTTCACACAC
TCCTCCAATTTTGTATCTCTCTTGACTGGAGTGTACCTTTCAGGGATATATGAGATGAATCTTATAATTATTGCTATGATACAATATACGAGACTATTCA
GGAGTAAATAATTGCCTGTACGTGTAATATTGAAAGAGTATGGTCATTGGTAGGCAAAATGACGAGGTTATCACCATGCAGTCTACTAATTTATAATACA
CACCATTTACAATTCTTCCACACTTTTAAGCTTCTGTACCATAATAATTTACTAATCCTATAACCACAACAGTTATGGATACTATCCTCGACCTCCTGTA
ATGTCCGTCCGGTACTTCTCCGTACCGCTTGCATTCATTCTGGACTAAAAAATTGTAAAAAGGTTATCGGAATTCAAGATTCGGAGGCACACAGTAGCTG
AAACGTCATCTCTGCACTCGTTACGCCTATCGTATGTCTTTGTGCTCAGCTTGGGCAACTCTCACGGTTGGGCCGCGGAACAAACGCACGGTCTTTTTCT
CTTTCGTCTACATTTTAAACGATGAAGAAAGCTGCAGGTGTGAGTATACCATCACACAAGCTCATCGCGTATTCTCGATGTTTGCACCGTCTATTGTTTA
GGCGAAACGTAATCTTTAAAAAAGCACAAGCAGCTTTTAGGATGCAACCGTGTGAATGGTATGCTGTCGGTCTCTAGTTTGAGACAGACTATTATTTAAT
TCCAGGAATGACCTACCGACGAATTAGCAGTATATATCTGCTGAACTGATAACAAGAAAGAATGGTTTATTATTTGGATCCCTGAATTATATCGGCTAGG
TGGTACTTTTGTATGTATTAATATTGTAATATCTACTATTATTCGCATTGGGTGATTAAGCTATAAGTTGAATATAAACCTAAAAAAATTCAATATAAGA
AATTACGGTGCAAATATTGGCTTTTAAAGAAAGGGGGTGAATTTAAGGAAAGAGGGTGTAAATATTTAATTCTTAATATTTATTACCTTAGCACTCACTC
AGGCGATGCTCGGTATATTTTGATTTTTGCCATTAAATATTATTTTTATTATTACTTATTCTTGTGGCCAATTGTTATTAATTATTCGGCAAACAATAAT
TTCTCATCTTGTGGTGTAACCTTTATACTCTATATTATATAGAAAAATTATTTAGCGTGCACTCCTACAAAATGTAGTTATCTTGTTTTTTATAAGGGAA
GATAAAAATTCCCAACGTCCCAGTAAACTCATGTTTACGCGGCACACATAAAAATCGATATCGTAGTCATTTATTATTACTAAATCTATATCCGCGGTTA
ACCCCACCCCATAAGGACAGCCCCGGAGAGTCTCTGCCGCGGGCGCGCTGTGCCGCAGCCAATATTTGCGGGTGCAGACGGCAAAGGGAAGAAGTGAACG
CGACTTAAAATCGTTGGCTCGGATGTTTTCATAGACAGTCAGTGCTGATGTGTCGTTTTTGTCATCTTTTTTGCTGTTATAGTTGGTGATGTTATTATTG
CGATTGTTTTATTATATTTTGCTGCTTCTGTTGCTACTGCTATCGTTGTTTCTGCTACCTCTGTTGCTTTAAAAGTGATTATTTTTATTTATATGTGTTT
CTCCTGTTGCATTTAATATTGCCGCTGCTTGTGCTGGTGGTTTTCTGCTGATGTTGTTGTTGTAATCGCTACTTTTGTTACTGATGGTACTTGAATTGTT
GTCGCTTTTGCTGTTGCTGTTGTTGGTACTGATAATACTTTTGCTGTTGGTACTGGTTAGAATTAATTTCCTTACTATACGATATTGTTACTGTAGCACA
TTTACTCATTCCTATAGACCCACGCTTCTACCCTATCTGATCGTCTTTCATATTATTAGTCTAATAGCCTTTGGACTTGATTGATTGCAGGCGTATTGCA
AGCAAGAAAAGGTGCGATAATGACTTAATCATATTCTATCAAAGTGTTTTTATATTATTTGCACGAAAACGTTGCTTTACTGGATTCGTTCAGA