Description :
From Genome Similarity Track
Location :
Scaffold_139:10794- 13501
Sequence
2707 bases(100 bases per row)
GAAATTATGGATGCCAATCTCTTCATGAAAATTTAAATCATTTATTGCACATCACTATACAGCCTTAATAAAGCCACAAATCATTTGCGGTAGGGTGAGC
TTACTGGATCAAAGAGCCATTTCGATCATACGGACAAGCGAAGTAGACTCATTGAGTTAACGTAATTGTAAAGCTCAACAATCATATGAATTAGCAACAC
CGAAAGCCTAATGGACTACATCTTAAGTTAGATATTTACACTTCGGCTGAAGCGTATAAATTGCTATAGTTTTGGAAGGGAATGGGTTCTCCGCTCACAC
AATTTTTGCTTTTCTCACACCCCTCATACCGATACCCAAAAGTCAACCATCGGTGATTGGCATATAGAGAATATTTCTTTTAGAAGTGTACCTACGAACG
TTCAATTCCATAGTGTTGAACCTTTCCTAATTCAGTACCTGTATATTCCAATATGGTGTATCGGAGCTTAAAGAACGACTTACCTATAATTCAGTTGCAT
TAAATGTGTGGTTAGGAGTTCCTTTAATAGATGGGCTCTGCACGTGTTCACAACATCTTGTAAGTATCCTGTGTGAGCATGCTTCAGTCGTCAATTGCTG
GAAAGTAGGTAAGTACAAGTAGAAGTTTACTGAAATCAAGAGCATGAGTCATGGTTAGAGGTCTCTATGACTTGTTTTGGAGATTTTAGGTATCCCACCT
TGGCAATACCTATAGCGCAGGTATCAAACAATACGGTGGGCTCACCGTATCACTCAGAATGGTAGTTATTACCTACTGATATCAGAAATACTATTTTTGG
CATTGATGGAGACGTAGCCGTTAATTGACTGGCTTAAGGCCAAGAATCTGCAATACGTTGCACATGCCACACAAGATTAAACATAAGATGTCGATACGCG
GTAGGTAGATTGTATAAAAATGACAGGAATCACGGACAATAATATGCTTTTTATGACTGATTGTTTAGATAATTCTATTATGAAAATCAGATAGGGCTAC
GTTTTTTCCTATTGAAGACTGCAGATTTCTTGTGCGTTTAGCTTGCAAACGATGCCAGCAAAATTATGAAGCAAATAATGAGCCAACTCCTCCACCAGCA
CTTGTATATATTGAAGTTCTTGCCTACATTCCTGTGATCTGAAGTTCATACGAATCTATGAAGAGCGATGTCCATGTTTCCATCACATTTGGCGCATATC
TCTTAGCAGGTATTTTTAAACTTTCTATGTGGTTTTTCCTCTTCTAGATCGACAACTTTTTGAGAATTGGTATGACTGGTATAATGAAGTTGTATCATAT
AAAAACAGTGGATTAAATTCGAGAAGTGCAAATTCTCTACAGTAATTTGAAGACCTAAAAGATAGCAAAGGTGCCCGGATTCGTGAGCAGCAGCTCATTT
AGCGAAAGTTTAGCTAGAGTGCTTCTTCACTCGCTTTCGCCCCGCTACAAAGATGACGTCCCGACCAAAAAAGGTTATTATATTAGTGTATTATACAAAA
CAAATAGTTTGCCAGCGGAATGAAGAAAATGCCGCTCGCACACAGTCGCAGCTGCAGGAAAGGTGAAACGTGAGTTTGGTCTCCTATAGGCGCCGGTCCA
GGAGACGCTCGACATCATTATATGTAATCCTTAGCACTTTCATGACGTGAAGTACGTCGATCTTAAGAGCAACAGACGCATGCGCTTGCGTTTTCTGCAG
TCCGTGTAAATTAGGTGATGCAGTGTCAAGCTAAGCACGTGATGCAGAGCGATGATCGGATTAAGACTAAGGTTAAGGAATCAGGTACGATGATGAGAAG
CATCCCGGACAACCTATTGCTGTCATTCTCAAACGGTTGGCTGTAGCCGTTCTAATGAAGTCACCATTTAAGGACACGTAGCTTCCACGGTAAAAGCACT
TCCTTAAATTTACGAGGAGAAACTTGCGCAAAGAGACGCCATTTGGGAAATCCTGACAGGGGTCCTGCTTGCTTTCATCTACAGCATGGACGAAACGGGA
CCGCTTACTTCCTCGCGATCGAAAAGACCATCACCAACAACGATTGGAAGGTTTGAAGAAGGGCAATATTGATTCGTGTAACGGTGGCTCTAATGTATCA
CGCTGACGGCTAGAACATGCGCGGTAAGTTCATATTTAGCCACGCGAAGTAGCCGCTCAGCATCCAGAAAAATGCAGGATGTAGACTTGGCTTCTACTAT
TGAAGCAACAATAAGGCGCGGACTACTGGTGGTCTACCTTGTCCGAGCTCGACGGGAATACACCGGCATGCGTGCTCAAATCAGAAAATATCGATATACT
CCTCTACATTGCATCAGCGCCTAATGCTATGGAATGGAGATGAAAAGCGTGACAGTGATGTCCCTTCCGCCAAACACGACATCAAATTCAACACATTGAC
GCCGGTATCATTGACAGTTGCCATCTTGATCCCGCTCTATATGTGAAGCTTTAAGGATCGCAGCTCAATCTATACATGATATACAAGCTCACGCGGTGAA
GTTAATATAATCCTGCTGGCGTGATGTTCCGACCGATGCTATTCTGAACTGATTTCGAAAGACAGGGATCGTGCTTGGCCGTACGACCACTTGCAGATTG
CACAATTGACGCTGATGATCAGCCAAATAGTAGCCTGCTGGCACAAAATATTCAGCTATGCATTCGTAACCCGATGGACCTTGACGAGCTTTCTTTTATT
CACCGAG