Description :
From Genome Similarity Track
Location :
Scaffold_163:107903- 113442
Sequence
5539 bases(100 bases per row)
GACGCGAGGGCTAACCAAGCCGTTCACATAGAACGGAGTGTAGCCTGTCGAGGCGTGCACTGCATTATGTAATGCGAACTCAACGAGTGGGAGCAGCTGG
CTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGAGGATGTCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCTGCGGATGGTCCGCTG
TGGACATGTCCAAACGAGTGCCGAGCACTCTAAAGAGGGACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATTGCCTCAGGCAAGCC
ATGTTGGCGAAAGACTCGGTCTAAAATCAGCAAAGCTGTACCTTCACCATCTATGGTGTCCGGCACCGCCGCTAGATGAGCCATCTTGCTCAATCGGTCT
ACAAAGACCACAATGCCCGTGTTTCCTGTCTTGTCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAACATCTCTTGGGGACAGGCAAAC
TCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTTGTCCGTTGACACGTCTCACACGTGCGTACATTGGAGCCGACCCACTTATACATCTTGGGCCACCA
GTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATACTTTAGATCCTCA
TCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGTGAGTATCGATGCAGCCTCGCGCGTAAGCGCC
CAGACAATTCGTTGTCAGAGTCGTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATCAAGTC
ACGCACTGACGACGTCACTGTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGTCACTACATTAAGCCGCCCCGGCTTGTACTTC
ACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATGATCAGTAA
AGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCGAGTAGCTCTTTGTCATGAACTGGATAGTTCTTCTC
TGCAGCTTTGAGCTGGCGAGACTCAAACTCGATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCA
CAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATCGGAGCCTGGAGAAGGCTCTCCTTCGCAGCCTCAAAGGCTCCGTCGTGCTCGACGT
TCCAGCACCATGGTGCGTCCTTCTTAAGGAGATCTGATAATGGCCGAGCCATCTCCGCGTAGTTTGCGCTGTACTTGTGCAAGTAATTGGCTAAGCCTAG
CCACTTGCGTAAGTCCTTTTGGTTCTTGGGAACCGGCAAGTCCACTATGGCCTTGACTTTGGCAGGATCTGCCCTTAAGCCACGCTTCCCAATGAAGCAC
CCGAGGAAAGGTATTTCCTCCGCGCCAAAGACGCACTTATCCAAGTTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAGTGGTCAA
TGTGGTTTTCCACGTCTGACTTTCCGTGCTCAGCACGACTATGGACGAATATATCGTCAAAGTACGTCTGAGCGTACGCCCGGTGGGGCCTAAACAACTG
CGTCACAAGACGATTGAACGTTGCTGGTGCGTTCGACAGCCCCTGGGGCATGACCAGCCACTCCCAGAGCATACCGCTCGGAGTACTCACCGCTGTCAGC
GGAATGTCGCTCGTTCTCATGAGCAATTGGTAGTAGCCATCGACCAAGTCGAGCGCGCTGTACAACGCACAGCCTACCATGTTGTTCTGCAGAACATCAT
TGCGAGGAATCGGCGTTTGCGCCGGGATAGTGGCCGCATTTAGCTTGTTAAAAGCATGAGCAATGCGCCACTTGCCGTTCGGCTTTCTGACACAGAACGT
GGGTGTCACGTGCGGAGACTTACTCTCACGCACCATCCCTGCCTCGTGCTTCGCACGGAAGAATGCGTCAATGACGTCACACTGCTCTTTCGGCAAAGGC
CATTGCCTTGTTACGCAGTATTTGGTTCCAGGAACCAGGTCAATCTCATGACACACGCCTCGATCCGGAGGCAGGCTCGTCGGTGGGTCTTTCGAGACAA
CGTCTCCATACTCCTTCACCACCGGGTAGAAGGGATCCGAAGGATCTTTGAGGATCGCCGATCCACTTCTTGCGCTCAGCGCCTTCTTGGTGTCCTCTAG
GACCGCGTCGTCCACGACGAATGAGGAGTTCAACTCCTCCTCAGGTCCCAGCAGGACCACCTCGGCTAGCTCGCCTGCCTTTAAGGCTTCGCCAAACTCG
GCAATGGACATCTCGTCCAGCTCTAGCAGAGCATCTGCAGCGGGCAGAGTGTCAAGGCTGATATCGCCTTTTACCTCCCCCGTCACTCCGTTCACGAGTG
TATACAGCTGTTCACAGAAATCACGTGGAGTATCACCGCTCGTCACGTTGGACACATCGTCCGACGTCAAAGACGTCACAGACGCCTTGCGTCTTCTTCT
CCTCTCCCTCCGCGACCGAGCCCGGCCGGAAGAGGGCGGTGTGGCGACATCTCCGTCACCACCGCCGGGTGCAGCAGCACCATCACTCCTCGAAGAGGAT
ACAGTGTCTCGCAAGACACTTGGCTGAAAGCCAAGAGGTCCTCGACCTTCACACAGTGAACTAGGTGTCACTTCACCTGCATCTCCTGGGCCACGCCCAT
GATGCCTCGACTCGTAGTCGACCGCGACCCTCGGGTCACGCAGCGGTAGGTCATCGAACAGATTCGTACCACTCAGTGGATTACGCGCCACTCCGCGCTC
GTCCTCACCAGGACCCAGCAGTTGGTCATTGACCTGACCTGCACCGCTCAGCGGCTAACGTGCCTCACCACGTACGCCCTCAGGGCAAACAGCAACCTCG
TTGCTAACAATTTCGGACATACCAATGTCCAGCACTAAGGCCGCCTCGGCCTCGTGCTCGCGCCAAAAGCGCTTCTGCTTCCTAGCAGAGGTGGGTTCAT
GACTCACCAAAGCTCCACTAGGAACAGGGTGCGACGCACCCAGCGTTTTCGACTGCCAGTCGATCCATGGCTCATGGCGTTCCAACCATGCCATGCCAAG
GATGAGGTCATACCTCGCATCCAGGTCTAAGACCAAACAGCGTTCCACGCTATCGAAGTTCTCAAACTTCACTCCAAGGTCGACAGAGAGCTTCGACACA
GTTACCAGTGTCCCCGTCGCGAGCCGGACAGAGATCGTATCTCTCGTTGGCACTTCCAGTGCTTCATCATACATCTGACCCCCTTCAAGGGTGGAGCGAC
GGGCGTAGTTGCCCGAGGCTCCCGAGTCAATCAAGACTCTACATGGCTTTGCAAAGCCCTTCACGTTCGCTTGAACGACCAGCAAGCCCGGCTTGCACGC
ACTCTTCTCGTAAGAGAGCTCAGCTCTCTTCGGGGCTGAGCCCCGTTGCCCTCTACCTCTTCGAGGCACAACAGCACTCAGTTCTTCCCCACTAGGCCGC
CCCGCGCCTACTGAGAGTTGCCGTTTCCCGGCGATGACCCGGAGGGTTGGCTCGCCGGATCCTCGCGCTTCTTGCGCAGAGGGCAATAGGCCCTCAAGTG
CTTAGTGCTATTGCACACAAAGCATCGGCGGATGCCGGCGCGCTGCTCCGCAGCAAGAAGCTCCGCTTCTTCACCTTCCGCATAGCTGAGGTCCATCGGC
TCTGGACCGCTCAAAGAGCTTGCGCTACCAGCGCAAGCTCTTGGAGGTCGCGCCGACCTGAAGTTGTGCTCGGCATTCAATGCCACATCCACCGCCTCTT
CGAAAGCGTTAGGGTGTACACGGAACACTTCCGTTCGAGCTGCGCTCACACGAAGTCCCTCCATTAACACGGTCACGCTGACCAGTTCCGGAAGAGGGTC
CGCCGCCATTCCGGCGATAAGAGCTATCAACTCTTGGACATAGTCCAATAAATCCTTCTTACCCTGGCGGGTAGCAAGGAACTTCGACCGGATACGGTAC
ACCTGATTAGGCGGCGCGAACACGCGCGAAAGCTGTTGCTTCAGCTGATCCCAAGTGGGAAATGCAGCGTCAACAGACGTGCCGCACGTTAGTACCCATT
CGCGAGCGCGACCTCCAAGCCTGGCGATAGCCAGCGCCACGCGCTGATACTCAGACTGGAGCAGGGCCGATCCCATGGCCATCTCGACCTCACGGGTCCA
GAGAAATAGATTCTCTCCATCCTTCCTCTCGAAGGTTTTTACGCTCACCATGAGCGGTTTCAGTCTCATAGACTCTTCACGCGTCATCGACGCCGCCGCC
GTTGCGGCGCTCATCTTCTCTTGGACATGCTCCAAGAGCGCGTTCTCGTAGCGGGAGAACAATTCCAGCCTGGCAGTGACCGCCTCTGGACCTTGCGATG
CAAGATGAGCCACGCCCTCCGGGCCAAGCAAGGACATAAGCTTAGTAAGCGCGTCCTGCTGCGCCGGGGGTAAATTCGCGAACACGGGGTGCTCCATCCT
CGCAGAGGATATAGTCAACCGACTCAGGAGCGCGATTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAAGAAGACGTTCG
ACTCAAAGAGTCACTAATACTAAGCTTCTTATCCAAAGGACACTTACAGCCCAAGACCAGGGCTCAAAGTTAATACCTTAACTTTTATGCTTCAAAACCA
GAAGTGTTTTATTTACTATTATTGCGGCCAAGCCGCCTAGGGGTAAATGTATCTCTTTAACTATCTAGCATAGTTAAACCTAATCAAATGCATAACGTGT
AGCTTTCAGCCAACGTACTGAGAAACCTTGTTAGCTCTCCAACTTATGTACTGAGAGTTTGTTAACTCTCCGGATACTCCGTACCCCTGTGTGTTCCACA
TCATGTAACCCGTCACATCGTAAGTGTGCTGACTGCTTTCCTTTAGCACTCGAAGGATGATACCAGTTTCGCTGATGTGCTTCTTGCTTTTATTGTGCAT
TTCAATGCTTTTGTCCATTTCACTTAGCCTGATGCTCGATTTATAATATAAAGAGACCCTTTTTGCAACTCTGAAAACAGGTTAAACAAATCGATGCCTC
CCTCTTCCCATCTCATTTTTACGCGTGGTTTTAAGCTCCGACCATGCTCGATATAGGCTATAAAACGGATGGACATTCCATCTGCAAAGCACAATACCAC
ATACGCGATTTCCAACCTGTAGTTTTGCCATCGTCTCTTTGGCAAATTGAGAGCGGAAAGAAATATCAGGCACATTGCTATTTAGGCTATAAGGACGTCC
GTTTCATTTTCAATGTCAGCTCCTTGTGTGACCAAACTT