Description :
From Genome Similarity Track
Location :
Scaffold_436:10788- 17661
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh-pve_contig_436-abinit-gene-0.27Histone acetyltransferase
Pytve_DAOMBR484maker-pve_contig_436-fgenesh-gene-0.3U11/U12 small nuclear ribonucleoprotein 35 kDa protein
Pytve_DAOMBR484maker-pve_contig_436-snap-gene-0.4Titin isoform N2-B

Sequence
6873 bases(100 bases per row)
TCGCCATTGCTGTCGCTGCAGCAGTCGGCTTTACGGACGGTTCTTGCAAGTCCATCGGCATTTCCAGAGGCTTCGCAAGAGAGTTCGCGCCGCCATTCAT
TGACATCGGAATTTCTTCGCTCAATAGATCATCCGGAGAAGGCGTAACCGCGGTACTCGGAGCACCAGAGGTCATCGGAAGCGGAGTTCCCATCATTGAC
GCACTTGACGAAGTGTGCGGCTGGTTCAATTGGGATGTGAAAGAGCCATGCGATGGAATTTGTGCCGGCATCGGGATCGGCTGCATCATGTTGGAACCGT
TCGGTTGCGCTTGATGATTCGAACCGCTCGGGTTGCCAGGAGCAGCAGCGGTGGACGACACCGATGAACCCATTCCCGAACTCACTCCCGCAGTACTCGA
GCCCGAAGCAGCCAACCGCGTATTGATAACGTGCTTGACAATACCCCGCTGGCTGTTGCACCGCTTGTACTTCACGTCCAGATCCTTCAGTGCGACACGC
TTTTCCCGCACCTGCGCGTCATACTGCGACTTCATCATCGGATCTTGGATTGAGTTCGCTAAATGGAGCAACTGCCGGCACTCATTCATGATGGAAGTGA
TCTGCGTGCGGATTTGCTCAGCCCACTTTTCCAGCTTCTGGCAGTGCAAATTCAACTGGTCCAGGTTCCATCCACGCAGCTTCTGCTGTATAAGCAGCAA
CTGCTTCCGCTCTTCCTCGGACAGGTTAGCAATGAAGTTTTTGCTATCTGTCCCAGTCGAACCATTCACAGGAGAAGGTGTCGACTTCAGAGCAGTCCCA
CTCAAATTGCCACTGACACTGGCAGGTTTGTTGGTGTTGTTCGCCAATGCCACTTGCTGTGACGTTGGAGACGATCCCTGGAACGACGGCCCCGCAGGAC
TTGCACTCTGCCCAATAATGGATGCTGGCGCAGGAATTGGCCGTGCATTCAGCTGTGCGGTGAAGTTTTGGCTCGGAGTGGCGTCATTTTGCTGCAAATT
GGCGGGCATCGGGATTGGCTGCGGCATCATTTGCACCTGACCATTCAGCTGAGTCTGGGATTGCTGGGCATTCCGTGCCTGCTGCACTTGCGCGGCTTGT
AACTGGCGGCGCTGTGCTGCATGGATTTGCTGGAGTGCTCGATCTGCGTCCAACATCAGCGTCCCATTCTTCTCCTTCACTTCAAACGGGTAGCGCACTA
CCTGGCACACGAGGCACTTGTTGTTCGTGCATTGCTGAAAATGAGACAGCACATACTTGGACGAAATGCAGTGGCTGTACGAGCACGAGTTCGTATGCCT
GCACGTTCCCATGTGGAGCCACAAACGCTTCATCTCACCGCAGCTGGTAGTTGCTGCACAGAACCCATCTGCAGCCTTGCACCACATTGCATGCCGCAAC
AACAAGAGTCGCTGTTGCTGCCGCTGCAGTACTTCCTTGGAACCAGCATTCTTGATATCGCTACTGGTCATGGACTGCAACTTGTTGTGGTATTCCTTCG
TTTGGGTTTCATCCAGCGCCGACGTCACCTGCTGAGCCTTCACCTTGAACTGCCATATGATCTGGGCAGATTTGCTGCGATTCGCTGCCGCAACCGCTGC
AGCAGCAGATGCAGCCGCATTGGTGGACGGGTTCATACTTCGACGAGCTCCGGGACTCGATACAGCCGATGCCACAGAACCACTAGTGTCCGACATAAGC
GCGTCAATCATTGACGATGATGCAGCTTGCGTTCTCGGCTCGGATTTGACCTGAGATGAAGCAGGAGAGTCCTGCAGTTCAGGTGGCATCTGAATCGCTT
GGGCACCAAGGTTGTTGCCAACTCCTCCCAGCATCCCGTTTGATGTCGATGTCAAATTGGTCGTAGGGGCGGAAACAGCTTCAGCTCCAGGAAATGGAAT
TGGCGTCGCAACCGGTGGAGTAACCGCTGGCGTTGACGTCGCGGGAGATGCCGCGGGCGTACCACCTCGCGTCGTGCCACGCTGATGCGTCTGTGCCGCG
CGCACAATGCTCTTCAGTCGAGATTGCAGCGTACCAATGTTCGCGTACTCCTCCCTTGACGTCGCAATCCGATAGCATTCATCTTCAAGCCGGTGCGCCA
TCTCAGGCAGCTTTTGTATCCAGTTCGACGGCGCGTTCGACCGCTGGCTCTGAAGAACCCGCATTATATGGTTTAGCATCTCCTTCTTCAACGCTTGGTC
AGCAGGTGAATGCCAAGGCTGCCGTGTAGCCGAATTGCTTGAGCCAGAAACCGCTGTTCCTTGTCTTCCGTTGGAGCCACCACCACTGTTTTGCTGACGC
TGGGGAGTTGACTGCATCGAAACGTCCGACCCAACCATTTGCTGCGAACCAATACTACCCGGACCCGACACCGCTTGGTTAGTTTGCTGCGCACCACCTT
GCTGCTGAATCAGCTGCGTCTGAGTCGATGGCTGCGCTTGCTGCTGTTGCTGTGCTTGCTGCTGTGCTTGCTGCTGTGCTTGCTGCTGTTGTTGCAGCAG
TGCAGTCTGCTGCTGCATCGCCAGTTGACGTTGCTGCAGCATTCGCACGTACTGCTGCCGCTCCTGCTGCTGCTGTTGTGCTTGCTGCTGCTGCTGCTGC
TGCTGTTGTTGCTGTTGCTGTTGCTGCTGTTGCTGTTGCTGTTGCTGTGCTTGCTGTTGCTGCTGGGCGAAGTAATATTGGCCTTGCATTGCTGGGTTCA
TCATCATGTTCATCTGCTGCATGTTGTAGCCTTGCATGAGCATCTGATTGGTGTTCGCCGCCGAAAACCCGTTTGCCGCGCCGTTCATCGAGTTCATCCC
CATGCCAATGTTCATCCCATTGTTCATGTTCAGGTTCATGTTCATGGGGTTCATGCTCATGTCCAGACCCATGTTCATGTTGCCAGACGACGCCATCCCC
ATGCTCGTGGCCGTGTCCATCGTGGTCATCGAGTTCAGCGACTCGGTCGCGAGTGCTGCGGGAAACGGAATCGCCTCGGCCGTAGAGCTGGCCAACGACA
CAGGAGCTGGTGTCGACGTAGCCGAAGTGTCCGCCAAGTTGAGGCCGGCGCTGACATCTGAGGTTGCCCCTGCGTTCTTGGGCGAATTCAGCTCGTCCGG
AAAGTCAATCATCCCGGTGGCCATCGAGGACGACGGACCGCCCATCATGCCACTCATGTCGCTCATCATCGTCATGCCGCTGCTGAAGTCGAGCCCTCCG
GTGCCGCCCAAGTCCATCGTGCCGCCGCCGAGATTGAACTGATTCATGAAGCGATTGTCGCCCATACCAAAGTCGCCCACAAACGTCTGCGAATCCATCG
CTTCGACGTGCCTTGTCGGCTACATTTCACCAGCAAAGAAACACACACGAGCATCGTCAGCACAACTGCACCTACGCCCGCTCAAGATGTTTCCCAGCAC
GCACACAGCTCATCAGCACAAAGGCAAAGCGAGACGCACCTCTCCTCAAACGCTCGAGCCTTGATCGAGATCACGCCACCCCCGCCAAATCAACGCGCGA
CGACTGGAGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATACGAAATCTGCCAAATCAGCCGCGGCTGTTCCCACACGCACACACGAGCGAG
GCATGTCAGCGAGTCTAGCCCACGTCATTTCCACGACGGCGCCGTCGCGGCCGCGCTCGGCCCTTCCCGAGACCGGGCCGACGCGCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAAAACAGACCAGCTACAGCACACACCTTGCTCTCCACGCAGCGGTAGAGCGATCGCCCG
AGACCCGGACGGGAGGGCCAGCCGCTCGGTTCCGGCGCGAGCAGGGAGACGGCGGGCCGGATAGCACGCCCGAACGGCCGAGGGAGCGGGGAGGCCGGCG
GGCGGAGGGGGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGACGACGACGACGACGACGAGCGCTGCCGACGCTGCCTCGCGCTTGTCGGGCA
GTCAATCAAACAGTGGGGCGGTCTTCTTTTCTTCAGAAGGTCAGCAGCGCGTGGGCGTGGAGTTACAAATAAATACACAAAAATTACAGAACTCGACAAA
AGAGATGCCGTAAACCCTGTCCGAGCCGCAAAGTATCAAATTAATTACGGGTGATAGCCTATATCGCCGAAAATCCTTCCAGAAACGTCGGGAACCATAC
CCAAAACAGACAGGACACTCGCCCCAAAATTGGTGGCCACCAACTTCAATCGCCGCCCCTTCGCGCGATTGTCCCCGCAGCGGAATCGTCGATTCGGAGT
CGTCCACACGCCAGAAATCTCAGTCAAAGAATGAGTCGGTTGTGGTCGCCAGTCCGTTTGTCAACCACCTGGGGCTGTTCGGCTTTCCCACGCCGCCGAT
GCGCGACCTTTGGCCGAGTCGAGCGTGAAGCCCCCGAATGCACTTGCATAAGTCAGAGACGCCATCACACACCGCACGCGCGATGAGGCTGCCGACTGCT
TGGCATGACGCTGAGGCTGTTTGCCTGAAGCTACGACTGGCGCAGTAATCCCAGACGCGCATCCCTGATTTAACATCACTGCTTCGCGGTCGGACACTTC
TATATCCCCCCGGTCTGATCCCGCTGTTGTCCGTCAAGTGGAACGTACAGTACGGTGTCCGTGACAGCTCATCAGGACGAGCGAGGACCGCCATGCTATT
CTCCAGGACGCGGTGCATGCTGTGCATTCAAACGTACGAGGTAGCATGAACGCTCCCAGGTGGATGATCCACATTCGCTGGCCATCGTTGTCTCGACCTA
CAGTAAGCACTTTGTTGTTGGCGACATTAGGTGTACAGTCACATTCCGAAATTTCGCGTTTCTACAAGCGGGGTAGGGTACAAACGAACATCTCCTTCGT
CAGGCAGTCACGGTCACAATTGCGGTCGAAGCGATGTGCAGAATCTGGCACCTCTCGTTGAGACCGAACGATGGCTTGCGGCACCGCTGGCACGGCGCAA
CGGAAGAACCCATGATGGCAGACTATTCAGCACCGGCAAAATAACAGACAGCGGTAACCTCACAACCACCCGTTGATCCTGAATTCGCCATGGGCTCTGT
GAGCAACACATCAGCTGAACCAATTCGGTTACTCCTTGCCATGGCCAATTGCCAACGCTGGTGGCGCCACGTTGGACAATCAGGCGAGTTGGCCAAAAGC
GACGGAGCTCGTCTTCGATTGTCAGCGTGACAGCTGATTTGAACCAGTCGACGCACCGAATTGGAAGCGATGACAGGTGCACTGGTGCCCGATATACACG
AGTACACTCGAACAGCTAACACTTCAACTTGTTAGCAGCTCGAAGGGTGCCGTCGCCAGCCATCCCCCGCGCCGGCTCATCGTGTCGCACTCGCCTTGCG
CTGTTATGTTAACACACGGTGAGAGCGCAGCGACGCAAAAGAATGTCTCCTCGTCAGCTTCAAGCTCGGCTGTGAAAGAGCCGTCCATCTTCCTTCACGA
AAATTACAGAAAGCAGAACCCTAACCGTACCTCTTCCCTGTATCACCCGCACATGATCGTAATTACCAATATCGCTTCTTTTTTTATCAAAAATGCAAAT
ATCACACGACCAGCCCAAAATACCTCCCTCATAACCCAAAACTAGTATCTGGCGTGTCGATTGCTTCACGCTGGCGGCGGACGGAATGGACGGTCGCGGC
CGCCGAAGCGGAGCTGGCCCGACTCCTTCCTACCGCTGAGCCCGCCGCCGAGACGCCGAGGCTTCCAGCCCTTCATGACGCGGCTGCGCTCGTAGTCGAC
GAGGATCTCGGCGCCGTCGATGCTCTGGCGGTGCGCGCGGCGATATGCACGCTCGAAGCCTCGAGTCTCGGCAAATTCGACGAACGCGTAGCCCTTGGAC
TGCTGCGTGACCACGTCGCGCACGAGCCGCAGGCGGCGGACGCGGCCGAATTGCGCGAAGAACTGGTCGAGCGTCGCCTCGGTCGTCGCGAAGCTCAGCC
GCGCCACGAACAGCGTCTTGTGCGCGTCGCCTTGGATTTGCGTGTCTCGCGCCGCATCGAAAGTCGCGAGGAGCGCGCGGCCCAAGGCGCGGTCGTGTGG
CGCCGTGTCCGTGCCGTCGATGCTGCCGACCTGGACCGGGTCGTAGTCCTTGGCGAACCAGAACCTCCGCGGGCCGTCGCGACGGCGGTCTGGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCGACCTGCTTCGACTTCGACTTCGTCTTGGCGCCATCAGGTATCTGCTGATAGTGTGTGATTCATT
GGTTGAAATGAGATAATAGACTGCTTTAATTGGCTAAAACATACCGAATTGATAGATATCCTCGAAAGGACACCTTGTCGAGCATGAGACTCAAGGTGCT
GCTCGTCGGCTTGTTGGCTCGGCAGCTGCAGACTGCAGCCTTCCGGATCCTGAGCTCGCTCGACGACCCGCTGAACGGCACGCACGCGGTGTTTGCGCCG
TACGAGCACGGCCGTGTTGGCTACTATGGCGATCCGACGGTGTTAGAGCCCGAGCGTGTCAATGAAGGCGGCCCGTTCTCGCCCGACACGCCTCGAGTCT
TTTTGTCGCAGCCAGTAGAGCGTACGAGCCGGTCGACAGTTTGGCCCGTGGGATAGTCTGGTCTGAATGTGTTGTTGCTATTGTAGAGCGCTGTCCCGGT
ATGATTGGGCCGATCAACGACAACGAGTACTACTGCCACGCGCGCGAGTACGGCTACTGCGACCGAAGAAGCGGACTCTGTGTGTGCAACCCGGGCTACA
CGGGAGTTGACTGCACTCTGTGTCAGCCATCCTATTTCCTCGTTGGCGAAGTGTGCCTTCCTAAGAGTGAGTT