Description :
From Genome Similarity Track
Location :
Scaffold_3:1078503- 1082796
Transcript NameFunction/comments
Hyaar_Emoy2800724hypothetical protein

Sequence
4293 bases(100 bases per row)
TCCTAACTTAATTATATCTGTCAACCAAATGTATGCTAAAGTCTTGCTCAACACGCATTGCACGCGTCCATCATTGATTGGACCGCTAGAGCTGGCTGAT
ATTATGATCCATATCAGCCAATCGGTGATTGTTTCTGAATATTACCCTTTATGGTAATATTCACGAAGATTTTCAACCTTTATGATAATATTCTAACAAA
CAAGTATCAAGGGTTAATTACATGTAACAGGCTCACCCCGTTACACAAGGGGCGTATGAGGATGCATAATGCTCGACACCGGGCCGAGCTATCGGTATCA
AATAGCTATCCATCATGTCCATAATGCACGAACTCCTCCCATACAATGCAAGACTGTGTACATATTGAGGATAGCTCATATGATTCATACATCCGCCTAT
AGGTCTGTGGCGATGCGTCGCACTAAACAGATGAGCCGTAGTGTGCTTTGCATACGAACCTTTACATCGCATGTATTGCCCGTTTCGGACTAGAATGCGC
AATGCTTTCTTGTGGACACTGTTCTTCCGTTGATACATAGACTTGACGACACCTGGTCGACGACCGCTAGTGGTCGTGTGCAAGGAAAGCATCGGGTGGT
GTTTGCAATGGAACATGATGTGACACTCATTGCTCACGCGTCATACCTTGCGGGAAGACTAATTTTTTTCTTTGGTTAGCACGCCATTGCACAGACATTT
TCTCGTTCAGCACGTTCCAACGATGAAGCCGTCGGCCGCTGCAGTTTGCATCTTTCAGCTTGTAGTTGTCTACATTACTCATGTCGAAGTCGACGGTTGG
AACGTGCACCTCGTGGGCTTCTGTACTAGAAATTAAATTGATTGATTCTGACACCTACCCATGATGCGAGGTTTATACATGAATGTCGATGGGACGCATC
GGTATTCGCTTGCCATGTTGCTAGCTGAAGAGAGGAAGTCAGTGGCGCTGTGATAAGGGATTCTGTCATTGTTTGTAGTGTTGTCTTTTCTTGTAGCGTG
ATGGACTAGCTGTTCTTGTTTTCTCCATCACTCCTGTCCACGCATCAGCCATCCACGCACCTGCCCAATCAATCACTCAACTAATCCTCAAACGCCTCTC
TAAGTCGTCAGCCGTTACTCCAACCGTATCTTCAACCATTTCGGGCAGCAACGTCTTTTTCTAACAATCAGGCTACAGCTGATCCCGGACTGCTGCTTCG
ATCATCTTAGACCGAGTTTTCTTCCATCTGAGGATGGAGCGCCGCGTTTGCCTAAATCCCGTACATCGTGCATAAACTACTTCATTCTGACTTCAGACTC
TCGTGAACCACGGCACCAATCATGCGTGTTTTTTTTGCGAGCGGGTCCAAGCGGCTCTGCTGTTGAGATTCAGATGATGATACTGTTCGAAGCAGGATAC
TTGACACGATGTGTTGGTCCACTGCGTTAGCAAACAGATGTTACATCGATTGCCTTTGTCGGCGCCTGTTTACTTGAGCTCGCGAGCTGTAGGTCTTTCC
TGGTACGAGTTCGAATCGTTGTGTATTCCGTCAATCATGTAGCTCAATCTCCAACGAGCTGAAGATGTCTTTCGATGCTATTGCTCGTGTAGACGGACTT
GAAAGCTCAGAGCTTTTTGGGTATTGGCAACATATGCATATGCGTGCGAGCGAGTGGATTCTCCGTAACCTAATAGAGCATTACGACCGAGGTTTAGGAG
ATAGGGGAGAAGGCGACGACGTGGAGCAGACTCCGTGTTAGTCTGTGTACTTGACATAGGAGTCGGATCCAACGTCGTGCTGATACGACAAGACGATCGA
AGGGTCGATCAACAAGGATGTGTTCATCATCACGTCCGTAGATATTCGCTCCAGCTGGAATCTACTTAACGCCACAGTCCAGCAAATAGTCCGAACACTC
GTCGTGTTTCCCTCACACCACCAATCCAAAGTCTTGATTCCAACCAGCCGCTTGACTATGAGCTTTACTATCGAGTACGTGCAGCAGCTTGGGTCTTTTC
AGATTAGCTGCTACTGTCGTCTGTCGTGACTGGCCGTCGCGTGAGACTCGACAGTCATTCCACATTTCGAGCATCTGACAGCACACGACCTTTCTGTCAA
CAGCGAGAGCTCATTACCAGTGTAGCAGATACGCACCCGACTCTCGACTGTCTCTAGTGTTGCAGCTACTGCAACTACAACAACAACAACAACTACTTCA
TCTCTCATTACGTCTTACCGGCTCGTGTCTTCCTTTTCTACTTCTTCTACCATGCCATACGAAAGCTTCACGCCACAGGAACACGTGGAGATCACTGAGG
TCGTGCAGGACTCGGCCACGAACGCGTGGATGTACGTGCTACACGTGCGTCGTGGCCTCGTTGAAGAGGGATTCAGCCACGAGTACGTCATTAGGCGCCG
CTTCAGCGAGTTCAAGCAGCTCCACACAGTGTTAGCGTCCGTCATGGGCGACGCCCTCACGCCGCTACCGGCTGACGGACTCTTGACGCTTCTTCTAGCC
GACAATCAGACGTTACTGGACGAGCGTCGTCAGGTGCTGACCCAGATCGTCATGGACGTACTGAACCACACCGTGGTTCGTGACCTGCCGGACGTGCTGG
AGTTTCTGGGCCACGAGTCCATCAGTGGAAAGGTCATGACCCCGCTCTCGGGTCAGTGTACGACTTCCATCCACAAGACGTCAAGTCCGGCTTGGACGGA
ACTCAACGGAATGTATCGAGAGGCCATCACATCGTCATAGGGGAGGCTCGCTACTTCGAATAAGAGTGGTGTCCGTTCTATTTACCCCGACGAGACCATC
TCCACCGCTGCGTGCAGCATTATTTAACTTGTATATAATAGACGTGCATCAATGTAAAAGTGGGTACAGGCAGTGACTATAAGTGTTCGAGTCGCAATTT
CGCTAATCTAAAGAAATGTTAGTGATACAGCAGCGTTGTCAGTGTGTGCTACGTCGAATGTAAAAAAGTCGACTTCAGTCATTCCTCGGATAAATTGTAT
CTTAATAACTCATAGCTCATACAATTTGCGTTCCACCATGCTCGTTCTAGAGTCACTAATTCATAACTCATGCTACTCTGTCCCAATTGTTTATGGACTT
TTAGGCGTATGGATCGCATTTTTGACGCAGCGCGTCTTTTTTGACAAAAATACAACCAGCGTAATAAGTTCTTTCTATTGCGTTTAATGCAAATTTTGGA
CCCCATTTAACTGCAAATCCCAGGTAAAAGATAGGGAAGCTCTGGTGCTCGTCCTTTGATAAAAGTAATTCAGTTTGGAGAACTGAATCAGATTATAAAA
AACTATACTTCAGCAGTCACTAAAGAATGAGTATGCTGTTATTAATGTCTTTAATAACCCAGTACATTATGCTAGGGAAACACGACCAGCCTTTGATTCA
TGGGAATATTCCTAAAGGTGACACGGTTTGAAATTTTGACCAGAACGTGACACGATTTGTCTAAAACAATTTTGCTATGGTGAAGAACCCTGGTACACTG
TACCGGTCTTTAGAAGGACAGATTAAATTACAATTTCGTTCAAGATAAGCAAGTAGCAGGTGTTTTCAAGTTAATTTTTGATAGCAGCCAATACATTCGC
TCATTACTACGCAAGTAATTTGTTTTGGAAAGGGAAACGTTAACCACCTACCAGGTTTTCGGTAACCACCCACCACCCCTTATATAATACATTAATAATA
TACTTTCCATATTTATGATTGGTCATAATAAAACGTTATATTCTAAATAACTCAGCCAATCCCAACACAATAATCGCATCCCAGGCGCAATGTATCTGCT
TGTTTCGTTCACTTTTCCGTCGGCCGATCCTATTGCTTCTGGATGAAGCCACAAGCGCTTTGGATCCTGAGACTGAGACATCGATTGTGTCTACTCGGCA
GCGCCTCTCGGGCAAGTTATACATGAAGATCATCTCGGTTACACATCGCTTGTCCATGTCTCTAAATACAGGCTAAAATATGGTACTTAATGCAGGACGT
GTTGCAGAAGAAGACCGTTACGATGGTTTGGTACAGCAGGGTGGTCTGTTTTACGAGATGGTCCAAAAGATGGATAAACCATAAGAGGATGAACCCCCTG
TTCCCATGAAGAAAATTGACATAGTTTCCATGGCCAAGGGCCGTGGTCATTCCCTTGTGCCACGTAGAAACACGGACACGGTCAGGAGAGAAACTGAAGT
AGTTGCACGAGAGAGCGCTAGCATTGCTGCACTTTACCAAGACTATGAGCTCGCGCGGGGCGCATGAAGTTGGCGACAATAATCGTCAAGCCG