Description :
From Genome Similarity Track
Location :
Scaffold_131:107836- 109205
Transcript NameFunction/comments
g3043.t1hypothetical protein

Sequence
1369 bases(100 bases per row)
GTACGATGCGTGCGTACCAACTAGAGGGACTCAGCTGGATGGTCAACCTTGCACACCAAGGTATCAACGGTATTCTGGCCGATGAAATGGGGCTCGGAAA
AACACTTCAGACGATTTCAGTGCTGGGCTACTTTTACGAGTTTGAGAACATTTCTGGCCCGCACATTGTCCTGGTGCCCAAGTCTACACTGAGTAACTGG
CTGGCCGAGTTCCAGCGCTGGTGTCCATCTCTGCGTGCCGTGAAATTCCACGGTAACAAAGAGGAGCGCCTGCGATGTGTTCAGGAGGTGTTGTGCCCCG
GTTTGCCCGACGAGAAGCGCAAGTTTGACGTGTGTGTGACTACTTTCGAAATGTGTCTGAAGGAGAAGACAGCGCTATGCAAGTTTGCGTGGAGATTCCT
CATTATTGATGAGGCGCATCGCATCAAGAACGAGAGCTCCCAATTCTCTACGGTCGTCCGTATGCTTGACACGGAGCACCGACTGCTGCTAACGGGCACA
CCTCTTCAGAACAACCTGCACGAGCTGTGGGCATTGCTCAACTTCCTGCTGCCCGATGTGTTCGCATCGTCTCAGGAGTTTGACGATTGGTTCAATCTTG
ATGTGGATGATGATGAAGCGAAGAAGCAGATGATTAGCCAACTGCACAAGATTCTGCGACCATTCATGCTTCGTCGTCTTAAGGCGGATGTAGAGAAGAG
CCTTCCGCCGAAGAAGGAAACGCTGCTGTTTGTGGGCATGTCCGAAATGCAAAAGGCACTGTACAAGTCGCTGTTGCTCCGCGATATGAACACAATTATG
GGCGGCTCAGGTGGTGTGTCCAAGAGTGCGCTACAGAACATTGTGATGCAGTTACGAAAGTGCTGCGGCCACCCGTATCTTTTCGAAGGCCAGGAGGACC
GGTCTCTAGATCCTTTGGGAGAGCACGTGGTGGAAAACTGTGGTAAAATGGTGCTGATGGACAAGCTGCTGAAGAAGCTCAAGCAGCGTGGTTCTCGTGT
GCTCATTTTTACGCAGATGACGCGAGTCTTGGATATTATGGAGGATTTCTGCCGCATGCGCCAGTATAGCTACTGCCGTATCGATGGTCAGACTTCGTAT
GAAGATCGCGAAAGCTCTATCGATGAGTACAACAGACCAAACTCGTCCAAGTTCCTGTTTCTGCTGTCCACCCGCGCTGGTGGCCTAGGTATTAACCTGT
ACACGGCAGACGTTGTGATTCTGTACGATTCGGACTGGAACCCGCAAGCCGACTTGCAAGCTCAAGATCGTGCGCATCGTATCGGTCAGAAGAAGGAGGT
GAATGTGTACCGTTTTGTCACGGCGGATTCGGTTGAGGAAAAAATTATTGAGCGCGCACAGCAAAAGCT