Description :
From Genome Similarity Track
Location :
Scaffold_29:107811- 111236
Transcript NameFunction/comments
Physo_344838ATP-binding Cassette (ABC) Superfamily

Sequence
3425 bases(100 bases per row)
CCTCCTTCAACTTCAGCAACTTGTACCGCTACGCCACAAAGTTCTACTCGCGGTCGGTATCATCACGACGGGAGCCAATGGCGCTTTGTTCCCCCTCATG
GCCATTGTCTTCGGCGATGTATTGACGGGGTTCACTACCACGCCTGTGGACATGGACAAGGTCAACAGCGCGGCTCTCGACTATCTGTATATCGCCATCT
TCCTCTTCATCACGGACTACGTCTCGTACGTGGCGTTCTACTACAGCGCCGAGCGACAGATAAAGGCACTGAGGGGTGAAGCGCTCAAGCACATGCTGTA
CATGGACATCAGCTGGTACGACGCGCACGACGTGCTGCAGTTGTCCAGTCGGTTGACGGGCGGACACGGTGAGGATCAGGGACGGCATGGGCCACAAGCT
CGGCGATTCGTTTCGATACTCGATCCAGTTTGTCGTGGGTTTTATCATCGGATCCGCCCATGGGTGGGATATCACGCTGGTGATGGCGTGTGTGATGCCT
GTCATGGCGCTCTCGCTCAGCTGGATGATCAAAACGTTCACGATCATGTCGGACTTTGCCCAGAAAGTGTATGCTGAAGCAGGATCAGTGGCCAAGGAGA
CACTGGGCTCTATCCGCACTGTGGCTTCGTTGAATGGAGAGCAGAAGGCAATTGAGAAGTTTGAGAGCAAGATTTTCAAGGCAGAGACGGAAAACATCAA
GCTGAACATGGTGGTGACAGTGGTGTATGCGCTGTTCTTGGCTAGTATGTGGATCATGTACTCCGTCGGACTCTGGTACGGCGGGTGGAATGCTTCAAAG
GGGGAACCAACGCCGGGGGGTGTTTTCGCTGCCTTCTTTGGCGTCATGATGGGAACAGGTTCTCTCGGCCAGGTTTCCCCGAGTGTTTCCGCTGTGGCTA
AGGCCGCTGGTGCTGTTGAGCAACTGTTCTCGATCCTGGACACTGCGAGTGCTATCGATGCGGAGAAAGAGGACGAGGGAATCATTCCTGACACGTGTGA
AGGCAAGATCGATGCGGTGAACGTCAACTTCACGTACCCGAGTCGTCCTGACGCCCAGATCCTGCGCGACTACAATGTCACCATTGAGCCTGGTCAGACC
GTGGCTTTCGCTGGTGCCAGTGGCGGCGGCAAGAGTACGCTGATTGCTCTGATTGAACGCTTCTACGACCCCACCAGCGGCACCATCTACCTCGACGGAC
GGGATGTTAGACACTGAACGTCAAGTGGCTGCGCTCGCAGATCGGCATGGTGTCGCAGGAACCTGTGCTGTTCGCCACGACCATCTTCGAGAACATCGCC
ATGGGTGGCGACAACGTGACCCGTGAAGAGGCCATCGAGGCCTGCAAGCTGTCGAACGTGCACAACTTCATCATGTCCTTGCCGGAGCAGTACGACACGC
TGGTGGGCGAGAAGGGCGTCTCTCTATCTGGCGGCCAGAAGCAGCGAGTCGCCATTGCCCGTGCCATTGTCCGCAAGCCCAACATTTTGGTGCTGGACGA
GGCCACGAGCGCGCTGGATAACGAGAGCGAGAAGATTGTGCAGGCAGCGCTGAATAACCTGATGGCCACGACCAACATGACCACTCTCGTAATCGCCCAC
CGGTTGAGCACCATCCGCAACGCGGACAAGTTCGTGGTGGCCACATTGTGGAGAGCGGCACGCACGACTAGCTCTTGAAGATCGAGCACGGCGTCTACCA
GAACATGTACCGGATCCAGGAGCTGCGATCTCAGGAGGAGCAGCAAGAAGCGGAGAAGCGTGAGGCCGAGAACGGACTAGAGAGTACGAAGATGACACGG
ACATTGAGTGGGGTATCGGCTAAGACTGACATTTCAGTGAGCGCGGTGGAGACAAACTTCTTGGACAAGAAGCCGTTCAACCTGTTTGATTTACTGAAAC
TCAACGGACTCGCGCGGAACCACTTTGTCTTTGGGCTGGTCGGTTCCTGCGTCGGAGGCATTGCGGTGCCAGCTTCAGCCCTATTAATCACGGGCATGAT
CACTGCTATGACGGAACAATACGCGCTCTTCGAGAGGACCTGGGGACCGATCTCACCTGACAACGTTGTACAACGACGTAGAGCTGTATGGTATTCTCTA
CCTCGTCGGCGCTGCAGTGATCGCGATCTTCACGTATCTGCAAATGAACTGCTTCAAGTACATGGAGGAGAAGATCACGACACACTTGCGCACCGCCAAC
TTCAGGGGCTTGTGTTGACAGAATGTTGGCTTTTTCGACGAGAAGGAGAACGCGACTGGCGCGTTGACTGCTGATTTGGCTACGAACGCCACCAAGGTTT
CGCTGATGTCTGGAGTCCCAAGCTGCGTTTACCCAAGCTGTCTTCACTTTGATCGCTGCGCTTGTCATCTCCTTCGGGTTCGGAAGTTGGCTGCTATCGC
TCATCATGCTGGTGCTTTTCCCCATGTTGATTTTCGGGGAGGTGGCGCGTATGAAGGAGATGGAGGATGCTGGTTTGATTTCAGATGACTTGGCAATCCC
AGGAGCCCACGCGTCAGAAGTCCTTGTGAACATCCGCACGGTTGCCGCTTTGGGTATCGAGAAGAAGTCTGCCACCACGTTTAATGAGCTGCTTCAAGAA
CCGCTGCGCAAGGGCCGGAAGGAAGAGCAGGTTAGTGGTCTGTCGCTGGGATTCAGCTCCTTCATCATGATGGCCATGTATGCGCTCGTGTTTTGGTTTG
GAGCCAAGAAGATGAACGGCGGCACCGTTGGTTTTGCGGAGATGATGCGGACATTGATGGCCATCACGATGTCGATCCAGACGGTCAGTTTTTGCCTCCC
GATTCTTGACTGACGGACCCAAAGCGTTCAAGGCCGGATCGACGATTTACGCACTTCGTGATCGCGTCGCCCCAATTGATTCATTCACCTCCGACGGATT
CCGTCTAGCCAAGGTTGCGGGCCGCCTCGAGTTCAAGAACATCTCGTTCCGATACCCCACGCGCCCGGAGATCAACGTGCTCAAGAACTACAACCTCACT
ATTGAACCCGGCCAGACGGTGGCGTTCTGCGGCCCTAGTGGTGGAGGCAAGAGCACTATCATCTCGGGGATCGAGCGGTTCTACGACCCCGTGGTTGGCG
AAGAGCTGCTCGACGGCCGCAACATCAAGGACCTGAACCTGAACTGGCTGCGCAGTCAGATCGGTCTGGTGGGCCAGGAGCCCACACTGTTTATCGGTAC
TATCGCCGAGAACATCGCGTACGGTCTGGCCGAGCAGCCGAGTCAGCAGGAGATCGACGAGGCCGCTAAGATGGCCAACGCGCACGACTTCATCACGCAG
TTCCCGGACGGCTACGAGACGCAGGTGGGCATGAAGGGCGAGCAGTTGTCTGGCGGCCAGAAGCAGCGCATCGCCATCGCGCGTGCGATCCTGAAGAACC
CCAATATTTTGCTGCTGGACGAGGC