Description :
From Genome Similarity Track
Location :
scaffold_22:10781- 11800
Transcript NameFunction/comments
g1173.t1hypothetical protein

Sequence
1019 bases(100 bases per row)
ACGGCAAAACTTAGCGGAAATGCCCTCGGCGGATCTTCATGCTTTGGATGAGAGGGTAAGTGCACTTTTTTTCGCTTGCATAGAAGAATAGTGCTCTGAT
TTATTTGTTTTGGTTTGAAACAAGATGTACGATTTGGATACACGTGTGACGAAAAAGCTAGTTAACGCAGGGGAAGATGCGATGAACACCGTTATTCAAG
AGATACACAAGAAACGCGGCAAGCCGGTACGCCTTGCGATTGTGTGTATTGTTGGATATGACGATTTCTAACATACTTTGCTGTTTAGCCTGTTTTGCTA
GAATCATTTGAAAGCAAGATTGACACGTGGGTGAATCAATTAAAGGAATTCCAGTCGTGGATGCGTAATGTTCAGATAGCCGTGGAGGACGCGCTTCGGA
GTAGGGGGGAAGTTCTACAAGAGACTGCTCAGCTTGCCTACTCATCAGATAGTGGTGTATCAAGCTCTCACATTGATGAAGCTAATGCAGCAGCTTTTCC
AACTGATGAAGAAAACGAGGAAGATCTGGCCTATGATGAAGCTGATTTTTCGTACGATTACGAACCCACAACAAACGAAACTCGAATGCACGGGCATGGA
TTATCTGAACGCCGGTTGAAAACAAATGAACGTGGACAAAGTATTCCAAACGGAACGAAACCGTATCGCCGAAAGAAAGCGGCTAAAAGTACAACATTGG
ACGACTTTTTCTTCAAGCAAGGATCGAGCAACGGATTAACGTCAAATTTCCGGCTCGTTGGGAAGCACAAGAAGAATCTTGCATCGGATCCTCGTTTTAA
TTGGGTTAAACTCGCGCGGAAGCAGCAGCAGCGTATGGGAAATGACACCAAAATGCGATCGACTGGTCGGGGAACCACGCACACGGTTCATGAAACACGT
ACGATAAAGACGGCAGCCCGCGACGGCAAGCCTTCAATTCAAGACCAGCGGTTCCGTCTTCGAAGCCAACGATTTCGTTCACAGCCAAAGAGGCTTCGAA
CTCGTGACACAGTTTACGC