Description :
From Genome Similarity Track
Location :
Scaffold_36:1078- 2506
Sequence
1428 bases(100 bases per row)
CCAGCTCCTCAACATGGGCAAGTCGAACGATGAAGTCGATGCCGTTCTCAAACGCATTCTCCCAGCTTAGGTCGGAAGAAACTTCACGTCTTTCAATTAG
CCTGTGTAGTTGGCTCAGGTATTTTGGGCGTATGGGTGACTTACTACTCCCCGTAAATAACAGCTCTCTTAATGATTCTCGTCTCTTCACACCCTCGCTT
TTGCTTGATGGTTCAGCATTGAACAATAGTGCTGATAATCTTCTTTCCTCTTCAGCGTCGGGGATACTTGCATCATCCCACTCGTCCGATCGGTCAAGGC
CAATGTTATGGAGAAGTACACATGCCGGGATGTGGTTGTTAACGAACTTAAACTCACTCACAGTCTTAAGCTGCGTTCGAATGCTCTTTAACGACATCCA
CCGATTTTTCCAGAGACCAACGCAGTTCTCATTTAGGACCCGAGCACTCGACACCACCTCATTGAACACCTTGTTGTCAGGATGGTCAGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN