Description :
From Genome Similarity Track
Location :
Scaffold_7:107784- 129969
Transcript NameFunction/comments
Phymu_g553hypothetical protein PHYSODRAFT_343758
Phymu_g554conserved hypothetical protein
Phymu_g555hypothetical protein PHYSODRAFT_343759
Phymu_g556hypothetical protein PHYSODRAFT_551943
Phymu_g557hypothetical protein PHYSODRAFT_343761
Phymu_g558hypothetical protein PHYSODRAFT_248383
Phymu_g559ferric reductase, putative

Sequence
22185 bases(100 bases per row)
ATGTGGACAGTCGCGCCTTCAACGCCACGACTCGAAATTTGTTGCTGTCCGTCAGCGCTCGCAGAGACTGAACGCTCCGCTTGGCTCAGCGATGAGGGCG
GACCAAGTTGCCCCGAATGAACATGCCACTGCGATGGTCGCAGCTAACGGAGGAAGTTTTACGACTGCGAAACTGCCGTGAACGGGTCTTCGAAGCAACT
AACAAAAAGCTTCAGGTGCACCTGAGCCCTTGGACCAGCTTGCTCGTTCTTTTTTGGAGGCCTCGCTCAGTCACTGAGTCAGTGAGCGGATCACGTACAT
GCGCGATGGCAGACCATTCTCTATGCTGCAACATCGTGGGACCCGCCCTCGTTGCCTGGCTCCACCGAGGCCCCGATCCCAAATTGAGATTCCCAATGCG
TGGTTTTCGAGCATACGATTCGACTGAAGGTAAGGAAGATGCAAGTGGCAATGGGCCAACGCCAATGGCAACCGCcagcttgctgcagctttgtGGCCGG
CGGCACATCTTGTTCCTTCCTTCTGCATCCGACGCAAGAAATGCAGCCGTGGAGGATCGGCACGCGCTGCTTTTTGATAGCGCTGGAGCGGATTTTCCTT
TgctctgctggtgcaggtTCAATGCTGGCTGCAGTTTCACCACAGTAGGTAACGTGCAGTTCAGCAGCGCTCGCCTGTCTGAACTAACGCGGCAACTTGT
GTCAGCGGGTCCGGAAGAGCCCAAGCCCCCGGTGTCGAAACCACATACAAACGCCCAGGTGGTTGCATCCTTTGACGGCCGACAGTGCCGGCGACGCTGG
CGTAACTCTTGCGTGGACGGGCCAAGAATTGTCGCGGTTCGACACCATCCAGCCGGAGCGCGGCGCCACACTATCCAGCGTCCGCACGTGGCGACGCAGT
CGGTATTTCCAGCCAACCGCCCCACGTCGACCGACGTACACACAGCCTGCAGTCAAAGCTCTGCACGTTGTACCATACCAAGGTACTCCGCCCGTCCAAA
GTCAGAGGCGGGAGCAAGGACTATCGCACCGGACCCCTTCAGACTGCGAGCCATTTAGCGTAGCGTAGCACAGATCAACCACAGGACGGCAATGAACTTC
CAGAGCGGTGTACAGGTGTTCATCCCGGCGGCGCTCAACCGGCCCACGCACACGCTCTACAGCATCTGCATGCTGGTGCAGCCCACCAACCAGGAGTGGA
CGGTCAACCGCCGCTACtcgcagttcctgcagctgcgcaAGGACATCCAGCACAAACTTGCCACGCGCGGGGTGTCGTGCGCCAACTGCGCCAGCTTTAA
CCGCGCCATCAGCAAGTTCCGCTTCCCGAGCAAGTCGCTATTGCGCACCAACTCGGTGGTTCGTCACCGTGTTTCAGCACTGCAGGACttcctcaagctg
ctcgtgggGCGCGTCTACAACGACCTCCCGAAGTGCGGCATTTGCGGAGAAGAAATCAAGGATATGATGCGGCCATTCCTCATCCGAGGAGCTCAGCCCA
TGAACGgctccatcatctccaagaTCAACAAGTCCCTTTCCCTCGAGTCGTACGCAGTGGTGGATCAGCCGGTGATGCCTGTACCGGAACCGGCCCCGCC
CATTTCGCCCTCGTTGGCCGGCAGGGAATTGTTCAGCGCCAGCAAGTCGTCGAGCAAGCCCATTTTCACACACAGTCAGATATCGGGCGGCAAGTCCATC
TTTTCACAGAGCAAGGCGATGATGAGTATGAGGTCGGACGATGCGTCCACACAACCGAATGAATCGGAGGATCCCATTATGGATTACTcggacagcgatg
acgacggcTACGGCAAGAAATACGACGATCAGCGCTGTTACGATGAGGGTGTTCCTCTTGAGGAAGCTatgaagcaggtggtggTGCCCAAGGGCGTTCG
TCTTACGTGCGAGGAAGTGGTCGTCCGGCTTACGTCGATGTGGGCCTCGTACGATCTGGATGCGGCTCTTTCTTCCTTACCGCCTGATCGACTTTCACAG
CAAGCCAATTTCTCTGTTGATGACAAGGAATACGCGTTCTAAGTGTCATGTTGGATAGTGCAATTTTGCTTTTTTCCACCTCGAGGGGTAGCTGCTAGCC
GGCCAACAGAGCCGCATCGCCCCATGGGCAGGGTGTTGTGCAAAACTAAGTATGAAGCAGTCAGTATAATATCATTGCGACCAGCACACGTGGGTCATCA
ACAATCATACTCTTCTGAATGGGACATATCACTAGGTCATTGCTGATTCTTCCAGACGGCATCCAGTCTCCTGCCGGCTATTACTGAGCTTCTATAACTT
TTCGGGATCCGCGATGCCTGTGGCGACCACAGAGACGCGTAACTTGCCGTCGAGCGAGTCATCAAACGTGGAGCCGAAGATAATATTGGCGTGCGGGTCG
TCCAGTTCCCGCGTCACgcgctctgcagcttcatccacttcaaagAGCGTCAAGTCGGAGCCACCCGTGATATTAACGATCATGCCCTTGGCATCCTGTA
CGGCAAGTACAGCAACGAATGTCAGCAGTGAAATACGCACAGAGGTAAGAATTAGATGCCGTACCTTAATCGAAATGTCTCCCAAAAGTGGATTCGCCAA
CGCATCCTCAGCAGCACGGAGAGCTCTGCATGGCACCCCGAACACATGCAAGCGTTAGCTGAATCAAACTCACTTAATTAATAAGCAGTTCGTTACCAAC
TGCCAAACCCACCGGTTGTCTCCATCAGCCTCTCCACTTCCCATCATGGCGTTTCCCATGTTTTGCATCACCTGCAGTTTCAAGTGAAAAGAATTCAATA
AATAAAAACTATTGCCAACAAGGATGAACTGACAAAGGCTGCGTACCGACTGAACGTCTGCAAAGTCGAGGTTGATCAGACCCGGCATCACCATAAGATC
GGAAATGTTCTTGACACCGTCAAGGAGCACATTGTCCGCCATTCTGCACAATAAAAAATGGTCATGTCAGCATGCATCTGTGCTGTCTGACCTGCAATCA
AATACCACAAGCCACACACCTGAAAGCGTCCATCAGTGAGGTGCGCTCGTTCGACATATTAAACAGATTCTGGTTGGGGATCACAAGCATCGTATCCACG
CTATCCTTCAGCTCAGCGAGGCCCTGCGCCGCGAGCTTCGCGCGGTTGTTACCCTCGAATCGGAACGGCTATGACGAATATTAATCGAGGACGTTACAAC
GGTGTCAAATGAATGATGTTGTGCTGCGGTGTTTGCATACCTTGGTGACCACTGCCACGGTGAGGATACCGGCGTCTAGCGCTGCCTGAGCAATAACGGG
GGCTGCACCTGTACCAGTTCCGCCACCCATGCCTGCTGTAACAAACATCTATAGTGCATAGCGACAAGGGTATGAACAAGTCAGTACATTGCACCATCAC
GAAGAAGTTTTTCCGCTTCAATTGACTCAACAACGCACCATATTTGCGCCTTGAACCCGCTCCAGGATCTCATCGAtcgcagcttcggcagcttcgcgac
TGTAGTAAACCGACACATTGATCGTAATAAGCCACAGTTCAACACGTTTAGATGATTGAAGTCGTTGTCACCGCACAAGCGAATCACTCACCCCACCTCG
GGGTTGGCGCCACAGCCCAGCCCTCCAGTCAGATCTGGAGCCATCTGAACGCGGTTTTCCGTCAGCGTCGTGCGCAAGTGCTGGGCGTCCGTGTTGCAGA
CCAGGAATTCCACACCCTGCAGGCCGCGCGCGATCATGTTGTTCACTGCCAATAAAGTTCATCAGCGAAAGCCAAACGCTAGACCTCGTTCACTTATCAA
TTATTCCACATACCTGcatttcctccagctccCCCGACACCGACCACCACAATCTTTGGCGCAAACCCCGACAAATCTGTCACAGGGAGGTCCTGCGTTA
GCCACAGCGGCTGCGTGGAGCTCATCACGGGcggcacgagcttcttctcgaccaCTGGAGGTGGAATCGCGCTTACATCTGTCGGGGATTCAGGCACCAC
CTCCACTTTCGGTGCGTCAATCTCGTCCTTCTGCGCTTTCTTGAAGCCCTGCAGTAAGTGACGAGTAAACACTCTGCACATGAAGTGGATGTCGGATAGA
ATGCGGAACTTTTACCATACGCAgcgcggcagcagcagcatcagtGGCTTCGGTAGAGAAGGCAAGGTGCTGAGTAGCGCCCTGGGTGACCTGGCGCGCA
CGCAGGAGCGCCGTCGTTACGGCCTTCATGCGGGAAATCGCCATCGGGAACTGGATCGCCACAAAATGATGAACGAGTTTTTAACTGATATAATAACCGA
TATTGTCGTTAGATAGAATATATTCCCCGTATTTTACCATGTATTTTATTTCGCGACCTGGTCTTGTTgacgaagctcctccacgttgTCCTTGATGTAC
AGCAGCACTTCCGCCTCGGTCAGGTCCAATTGAATGCCATAATTACGCCCTACGAACGTGCTAAACTCGTCGACGTCCGAGCACAACAAGCGCCCAGTGT
CCGTCCAGATGACCACATCACTGATCACCAAGTTCGACGATGTgggcaagttgaagctgttttcGGTGCGTAGTGGTAAGTCACGGGAATACTACAATCC
AACTTGCACTATGCAAGCTTACCCGTAAACACGCATCAACTCGGCTGCCTCGTTGGGCCAGCGGTCGGCTCTCGATGGGCGCTTCGTTATTTGGCAGTCG
GGTAAGGTCTCTGCCAGGATGTCTCGATAGTGTCATAGCCACTGTAAGGAAAACAGCAAAGCTagctactgtacatgtgcatgtatGGATAATGCCACTC
CCTACCAAGCAATCGATCGCAGATAGCGTATTCTTCGCTGCTAACTCGCCCGGCCAGTGTGTAGTGCACCATTCCGATTGTGGCAAGACTGGAACGCAAC
TGCGCTCAGAATAGATAAAACGCACAGTATAAGAGCTCCTTTGTTTGTTGTAGATGCCCTGTTCGAAGGTTGTAGATTTTACtctttgttcttcttttAT
GCTTCGTTCAAGAATATCTTATCGACGTACATATTAGGTAAGAATAACAGTGCGTATGCTGGCGAGGGTCTTACGAATACGAAAGTGGCGTCGTAGCACA
GCTGTACCAAAAAGTCAGATTTTCCGACAAGTGTGGTTCGAATAACTCCTATCATATCTGTGTTTCTTGTAGAGGACACAGCCCCCAGTGTTCCCTTCAA
TTGTCATGTTCAACAAGGATCGGACGATTGAGTTATCGTAATCGTTTATCCCTTTATAGTTTCCACTTACACCCTGTAAACGCTTTCTCAAACACGAAAA
TCACTCGACGTTTTGCTGGCTGAAGTGCACCCAACTCCCAAGCTTCATCTCACCGCACAAACCAGATGAACTTTAAGTTTTGCGGACTCGTGCTTCTTAG
CGCCGTGGCTGCCACTGCGCTGACGTCGGTTGACGCTGAAGAATACCCCGGGTATTGCTGGCCCCAATATTGTGGTGATACGAGCTCCCTGAAGAGCAAG
GCCCCTTTCAGTGCTGCAACGGTCAGCACTACTTTGCCAGTTGCTGTCAGAATTACTGCAACACTGGTGAGTGCGTCAAGGGAAGCAATTGGTAAGGAAT
GCCGATTTACTGCATCTTTAACAAGTGTTTCGAAGTCAGACAAGCTTCTTTTTAAAGAGCAGGTTCACATAACTGTCAACGTGTTATCTTTCTTGTAATA
CAAGTTGTATTTCTCTGGGCTACATCACCCTTGAAGCAGATTCACCTCGATCATCTTTGCATACGCCGGAACAGCGTCGGCTACAGAGTATGTGTGGCAC
GTACTTAAGATTCACCTTATGAGCGGGGCCCCACCGTACTCACTGCAGAAAGCAAGCTCGATCTTTGGGTGTCTGTCAGACGTCCTCGCCCTCCCCGTTT
GAATGGACCCTTCTTCAGTGCACCGTGCATTAATATCGACTATATGCACTCCAACGCGAAGAGGCTGGCTTCATCGACGCTGTCCAACCAGCAAACTGGC
CTTTCAAGATAACAAGACCAGTATCTGTGCATTGTCCGAACTCCAAGCTCCCGCATTATGTCCAAAAGCATCGCCGCTACTGTTGCACCTGGTCATTGGC
ATTCGCATTCTCTCGAcgcttcttggcttcagAACCAACACGTTTGAACTTCTTGCTCTCTGTCTTGTTCTGACCGCGATACTTTTGTTTATCCCAACGA
GACATCTGTGAGGAATCCCGGCAACCAGAACCGCCTTCCCAGTGACGAGAGGTAGTCCTTTTCGCTGCGACGTCGTTGCCACAGGAACACACCTTAACCG
AGCTTGATTGCTCCTTCGAGCACAGGCCACATATCATCCGACTAGCAAATTTTCCCAGGTTAGCTTCGGGGCAATCACTCGAATCATGGCAAACATCGCA
CGGGAAAACCTTGCCACAGCACTGGAAGCGAAACCAACGAAGCGAGTGTTTGTAGTGATCGCACGCTCCATTGCGAGGCAGCGGCTGTCCCAATACAAAT
GTCTCGGCGACCTGCTTGCCTCCTTTCTTGCGGCTTTTTGCTCCCTTTTCTGCTGTGGCATCCGGCGAAGTGCTTCGCATTCCGCTTGATCCATCCACCT
GGCCTGCCACAAAGCGCTTTGCCATCACAGCAAGCTTAACGTGACAAGAAAAACACGCTTGTTCCGACCGCTGCCTCGGCCGTAGCCTCTCCAGCAAAGC
TTCACATCCGCACTCCAAGCAAGTAGCCAAGACATCGGAGGGGAGCACATCCACAATGGCGCAATTCTCGGTGTCTACAACAGCTAGCACATTGCTCTGT
GAATGGGCGAACATGGGCTTCATAAGTACGTGGTGAAGCACACTACAACGAGGGCACCACTTCTGAATTTCCGGTGAGTCCAAACTTAAGACAGCGTCGA
AAGTGAGCGGGCAGTTAGCGCACTGGACCTGGCAAACGAGTCGATGCGCAACAAGCGTACCAACTTGGTGCAGGAATAGATCTTCGAGGCAGATTGGAGT
GCCCTTCACTCCGAGTTCAGTCTCAATCGTAACGCGCTTATTCGCAGGTATGATGTTTGCATTTTGAACGCGATCTTCGCTCTCGGCTTGTTCCGGGGCT
gtttcttcctccttcgcctctTTCTGCGACACGAGAACGGTAGTGGGATCTACACCACGCCGCACCAGCCCACAAAGCATCTTGAAGCGATCGATGCATT
CATTCAGAGATCGACCTTCGACCTCGTTGGCAATGCTGGTCCAACGATCCTGCTTGTCCATTGAAGCTGGATATTTCTTCAGCGCCAGATCGagagctcg
ctgctgcatttccGACCAAACTTCGCTGTCTTCACGCTTCGTTTCAGTGTCAACACTGCTAGAGGACACTGACGTACTCTTTACACTTTCCACCCCTGTA
GCTGCATCCTTCTTTACAGCCGATGGACCCAGCTGTACGACGACTGCGCGTGGTGAGGCGCCAGCCCCTGCCTTCTGTACCTTGGTATTTGCGCCGGTAT
TCTTGAGATCGTGTGAGAACTTGCACTTGTCACCGTCGCGACACTTATTTTGTGCGAAAAATTTGCATTTGCGAAGACGtagcttcttctttttcttcgg
TTGTGCCTCCGGTTTTGCAGATTCAGGTGGTTGTGCCGGATCAGCTTCCCGGACAGCGTTTTCACCACTAACTCCAGACTTCtcatcgccgccttccaTG
CTGCTTTTACTCGCAGTGTGCGAGAACTTGCACTTCTCTCCATCTCTGCAGTTGCCTCGTGCGAAGAAGCGGCAAGGTCGCTGGCCACGTCTCCTCTTCG
GTTTCTTCTCACTGGATACAGCTACATCTTCAGCCTCAGTCTCCTCAGTAAGGGTctcatcgtctccttcttgtaccTCCAGATCTTCCTCCAAAGGCGC
AATTGTCCTCCAGAAATTGTTGTCGATCCAGGTCAGCAACTTCCTCAGCGAGAAGCCCCcgcagagctgctgagctcgTGCATTTACGACTGTATTCAGC
GCTCCAATCTGCTCTGGTGATAGTCGACTACTCCACTGCGCAAAATCCACGTGAACAGCTTCCACTGGGTATTTCCCAGGTAGAGTCATTTGCAGCTCCA
CTTGGCCTTTCAGTCGCGCAGGCAGTTCTGGATCCGACagactcaagaagaagcgcacgtgcttgtccagcgttgcagcgtcttcactgaTCAACTGCAG
ATGATAGCGACGTTCCAGCGCCATCCATTCCTTCTTAAAGGCGTCGGTCTCGCTCGCCAGAGCCTCCTGCCAGCTTTCACTTGccatcttcgtctccaat
TCCAGAATAGAATCAATTGTGAGCTTTTGAAAAAGTAAAATTGTGATATTCACAACGGAATTGTGATTTTCACTGGTACCGGAAGAAAAGTTCTGAGAAT
TTTCGGTTCGGAACTCATAATTTACCGTAATTTACCATGTGGAGCATCCGTGTTCGAGGGCCTCGCGGCAAGCAAGTGGTGCTGAAAATCGACCCAGATG
CCCGCTTCAAGACGTTCTCGGgttcgtggagctggcgctgctctCACCGTGTGCGTGTATGTAATTAATGTCTTTGTTCCGCAGAACTTGCAGCCAAGGA
GTTGGGCCTGACACCTAAAGACTCACCCACATGTACTTTACATATCTGACGTTTTTCAATTATTGCGTTGCTAATTTATTGTtgcgtgctgcagttcgca
GAGGTTTTCCTCCTCGGCCGGTGGAAGTGGAAAGCTCAGCACTCGTCaagttcgtcttcgaggCCAATGAcacggtggtggtggacaCGAGCTCCGGTGC
TGCGGCGCCAGTACAAGCAACCCCTACGAAGAAAACTGCCGGGAGACCGAAGCGAGCAACCGTAAAGAAAGTTGCTACAAAAGCACCGAATGTCGGAGTG
CACACGCTGAATCCGCCGACAAAAGCGAAGAGAAAAGCGCCTCCGAAACGGAAAATCACCGGCAGTGGGCACCAACTTGGCAGTTCACTGGAGAATAACG
CGTCCAATGTTGCTGAAGCTATAGgggaagacgaggacgaacCACAACGCAAATACCGTCGAAATAAGGCGATTAACCTTACGTCCAAGGAAGATGTGGA
GATCAGTCTGGTGAATGCTGTCAGCGGTCAATCCAACGATCGTGCAGCCAAGTTCTTCCGAGCGGCGACAAAGAACGCAGTGGAGCATCAATATGAACTG
ACGCTGGCGAATGCGAGGCTGAATGCCGCGTTGGCGCATAATTTTGAGATTAAAGAGCTTTCAAGTACACGACGAGCTGACGGTAGTGCTGCTAAGCTAC
ACGTGCGCTTCAAGGAGACGCCgcgcaagtggaaggaaGAGACGGTTGATTTACTGAAGGTAGACGAACTGCAGGCCATTTTGAAATACGTGCTGCTGTC
AGGCGGTGAGACTGGTCGTGAGATGCTCAAACCATTCAACATGGCCCAAGTATCTATTAGGGTGTTTTGGAGCATCGCGCGCTTGTATGATGGAGATGTC
GCTGCTGGTCTAGCTGACCTTGTACCCGATGAAGACTGGTCGTTCATCGATACTCGTGCGCGGTAAGGTTTTGTAGTATTGTAGTTTACAGCACGAAGGT
TAACCTGACTGATCGTGCGATGTTGGCTCGTTACAGAGTGATGTCTGAGAAGGCTATGGAAGCGATGGTAAGTATCGGATCGCGTTAGTTTTATTGTAGC
TCTTCTCGATTGAACTGATAATTTGTGCCGTGTTGTTTTTGTGTGTAGCAAAATGAAGAGCAGTATAAGCTGTGGAAGCAGGAAAAGCAGGACGATGCTC
AGAGCAACCGTACATCTTCTTCGAAGCCAGAGAGCAAGGAGAAGACAAAACCAGCTAAGCACCCAGCAGCCAAAGAGACGAAACCCGAAGTCATTGACTT
GGACTCAAGTGGTGACGACgaggtcgaagctgccgaggCAAAGCGTGCCGAGGTAGAAGCTGCCGAAGCAAAGCATGCACCGCCAACGCAGACCCCCGCT
CTTTCTGCGAAGGAAGCGACCCCTAACACCCTGCGTAGTGTAGCTGCACAAGCAGCGCTAGCCCGGCTCGACCGAAACTCGCAGACAAGTGCTGTTCTGT
CTGCttttcttcgagaaggaaaaTCAGCTTTGGCATCGCCTGTTAAGAAAGAAGTTATCGTCGATGAGGATGACACTGagtccgaggaggaggtggagga
agctaCTACGGTGTACTGCGATTCTTGCAAGAAAGCGCGCATCCTATCGcccgaagaagcagaaaacgCCGAACTCGACAAGGATCCATGGACTTGTGCC
AGTTTGGCGAAAACAGGACGTAGCGGTGGATGTGACGCTATCGACGATGAAATTGCTCAGATCACGGGCGCCTCCATTGCTGAGTATCTGCGAAAGGCTG
CAATCACCACTCGACAAGAGCTAGCGGACGCTTCTGTAGGAGTTACCATGCATGCTCTTGTGAATCCATTGGACCCTTCTGCTCAGATGCTGCaagagaa
gctcgagaagctgatTGAAGAGGTACGTTTGTTTGTCTGCACTAAGCTGTTTTACTGGCATCTGGCTAATGGATGCGTGTTGACGAACTACTACTAGGCG
CGTCTCGATGTGGTGAACGATATGATACTGGAAATCGTCGGTGAGGCTGAAGTAGTCGATCGGCTTgaggtgcagaagctcgGAACACCTGCCGATTTGA
TCGCCACACCGAGCGACTTGATCCTCGAAGCTGTTGGTGGCGAAGCTGATGTTTCTCTCGAGGTGGTCAACTCCTGGCAGGCCCGTGCTAAAGCGTTTGT
GGACGAACACCCCTGGCTGGCGGAATGGCGCACGCTGTAAGGCTCGAACTTCTTTGATGAAGCATTTCTGATGGAGTAAAAAGGCACAACtctacttcga
agtatttgaAACCGAAATGAAAATTTATTGCTCTTCCGCTTTCAGGCATTCTGTTCTACACACAGCAGGCAAGATCGACTCGAAAATGACGCATTGCTGG
GGCTGCCACTAGTTCGCTCCTGATGGTAACTTCCATAATTTTCAAGCCCATGTATCACCCTCTTCATTGCCGCTTTGCCACCCAGCACCTCACAGCATTA
CGCTGGTGACTGGAGCCTTGGATTGCTAACTTGGTGACCTCTTAGTCGATCTTAATGGAGCTGTAGATCTTGCGCGTAAACCAGAGGCACGCGAAGTAGC
CGATGGTACCCGTGAGGAAGAAAAAAGTGACCGAGATCAGGAACATGTAGCCGAAGTACAGGATACCAGAGACAAAGGCCGTGATGTTGAGCTTCGTGAA
GAAGTACAGGAACGAGTACAGGAACAGATACACGGCCGCAGATCCCGAGGTGAGGAacgagcgccaccaccagcggtAGTCCTCTgcgcagagctggaag
taGCACATCACAACCGTTACTTCAGCGCACGTGGCCACAAGGATCAGCAGCACAATGAACAGGAAGCCGAACACGTAGTAAATCTGGTGCAACCACAGCG
CcgacatgatgaagaacagCTCAATGAACACGGCGCCAAACGGCAGGATACCGCCCACGAGGATGCTGAAAGGCGAGGACAGGTACCACACTTGCTCTGG
GATCTGACGAGCGATCTGGTTCGTGCGCACGGGCTGctcaatggcagcagcctTGAAGCCAAAGTAGCTGCCCAGGAAAACGAGGGGAACCGAAATACCG
AACCACAGGACAAGCAGAGCGAACAACGTTCCGAACGGAACAGCTTGCGACGAAGACTTGCCCCACAGCACCAGGTTCAACAGGAAGAACACCGCGAAGA
GCAGTCCCGGGTACAGCACAGCCGTAAGAATCGTGTttttcttccagtccttGCCGTTGAACATCTTGTACGTACGTGACGAGTTGTAACCAGCGAAACT
GCCCATGAACacgaaaagcagcagcagcgtcgtcagaAGGGAACCGCGGTTGGCCGGCGACAGTAGACCCAGCAGCGCAATAACCATCGTCGATGCGCTC
ATGCAGCACACCTGCACGCCGGTACCCACAACCACCGAGAAGAGCATGGGCGAAAGTTGAGGCGGGCGGAACACGTCGCCATGGACAAGCTTCCAGCCGG
ATTCCTCCTGCGCCTCTTCCGTGGTTTGCACCTCGTTGTAGCGGGCGATATCACGGTGAAGCGTGCGCAGCATGATCATAGCAATCATACCGGTCAGGAA
CAGAACGATCATGAGCGAGTTGATAATGGAGAACCAGTGAATCTGGTCGTTCGcgctcttgctgctgatAATACGGTCCCAACGCTCCTCCCAGACGATA
TCGGACTTGACAAACTGCACATCGTACGTGTACAGCACAGTGGTCTCACCCTCCGGGTTCAGGTACTGGTAGTTGCCCTGCGAGACTTCTTCAATGTTGA
CGAACTTGCCGCACGTGTCCGAGTCCAGTTCCTGTCCAGCCATAGGCTCGTTCTCGTAGCTGTGCTTGATCGAAGTGGGCACCACCTCGAAGCCAACGAC
GCGCCACTTAGGAACATCGCCGTCTTCCTCGGCGTACGGATCCGCGTTGACAGAGATGATAATACGCACGTGGTTGTACAGGAGATACTTtccgtcctcg
tccacttcgCCCACGGGGAAGCCACGCTTAAAAGATCCAGCCTGCTGGGAGTCCGTTGGGTCGCGGTACAGCACCGGGAGGTTGTCTACCACCCACTGTA
CGTAGTACTCGTCCTTGATCATGTCAATGAAGGACTGCGACTGCTCAGACGTGTAGGTCATGGGCTTACACAGCACCTGGCAGATagcgtccttctccat
ctgcatgTTATACAGGGAGTCCATGATAGCGTCGCCTGCCATGATCTCACCCAGGTTCTCCTGTTGCTCGTTAGTGGCCGTGGGCTTGCAGAAGGGCAGG
TAGTAGTACTCGTACGGCACCAGCGTCTTGGTGGACGTGATCTTGTTCACGTTGAGGCGCACAGCGTCACCCGCGGCCCAGGACTCGGGGGCGACACCAG
GCACGTAAAAGGCCGCGCTAGCCTCCTGCACCGCCAGGAGcgcagccagcgccacgctcttcatccacatcGTGTGCTTAAAAGGGGAGAGGAGGAGGGA
GGGGGAGGACGAAGTTATCTATTGATACTGCCGCTTGCCGCCCGACGTctggcttcttcttgggcgaATGAGGGAGTGCGACTTTGGCTTGCCACGAAGC
TGGCACGAGACTAAATACCTGTATATATCGATGGATGGAAAGGAATGCACCTGTAGAAATAGATATGGATAGTGGGAGAGCCGAAATATCAACCAATCGT
AGATTGTTAAGACGACTATTGGACAGAAATGAGACGAATCAGCTGCCGACACCTTTTTAAGGTGTAGTTGAGGTGCACAACACCAACAGTACGTCATATA
GCGTGGGTCACACATACCCTCGCATTTCCGTTGTACTTCGATCCCTCAACAACACAAGAACGCAGCTCTAGACTTGggagttgaagctgccgcGCTACAC
CGGATCTGCGCCACCACACGCGTGTACAAGGTCAGCAACTGCTCAAGTCTACTTCCATCACCTGCTCAGCGAGGTAAACACTGACGGAGAGCCTGCTGTG
CGTGACGCAACCAACGCCGCATCCCGCTTAATTATAGCAGTTGGAGGTCTGATTCTATTGTCGTcagtctccttcttcgtATCCACGTCGAGTCTGTCTC
CACACGCCAGTCGCTAAAGTCAGAGTCAACCGCAGGGTCGTGTGGTGATCGAAAGCGATGGAGGTGGCCGTTGTGTCCGAAGAGGTGGTGGCAGAGGCTC
TGCACCAGCTGTACAGCCCACTAAGTTCCCCGCGTGTGCGTCGTCGCGCCGATTCGCTTCTacagcagttccagcgctCACCCGAAGCTGCACAGACGGC
GTTGGCCGTGCTACAGGCGCCTCTTGTCGACACGGGTAACGCGGAGCAGAATGGATTGCTGAGAGCTAAGCGGGCGTTTTCTGCGTCTACGATCTACTTT
ACAGTGGCGTCGTACATCCGCAAGTACAAAATGGACAACCCTGCCAACTGGACGCCTGCGGAGCGCGCGCAGCACGAGATTCTAGTAAAGGAGTTTAGTT
TAATGGCTCAGGACGTCTGGAATGTGCTGACGGGGCCCAACGGCACGCAGGAGGAGCTTAACGTGCAGACTCACTTGGCACTCACCATTGCAGTCATCCT
GCTACGTTTCCACGAGCCTCAGGGGGCCATCACTGTGGTTGGCGCAGTGGAATGGCTAGTCCAGAACCAACAACACCCAGTTAGTGATGGTGTGACGGCT
GCCTTGACCAATTTTGCCGTGCTGCTTACGCTGAAAGTTATTCCAGAGGAAGTGGACAACAAACGAGTCAAGTTTTCCAAGGCCAAGCGGGTGTTTTGCG
AAGACATGGTGCAGCAGTGCGCAGCCCATGTGGTTAGTACTGTTCTTCCTTCGATTGCCACTGCTATCGATACTAGTGAGGAGCAGGTGCAGTTACGAGG
ACTGCTTTTGCAAGCATTTGCGAGTTGGGTGGAGCATGGAACAGTTCCACCGCCAGTTATCGTAGAGTGTGGGCTGTTGGACCGAGCTTTTCGAGAAACG
TTGGTACCAAGCTCCTCAGAGCATGCGTTACAAGTTATACTCGAAGTGGTGCGTGTCTGCCGCCATGACGAGCATGTGCAACTTATGGAGCTCGTTATGA
ACAACTTTGTGGTGCTTGGGAAACATATCCAAGAGCGCATAGCATCATCAGAGAAAAACCTGGATTTTTGCCTTGCCAACTGTGCTAGAGCGATATCTGA
GTGCGGCCAAGCCTTCATCGTATACTTTGTGGACTACACGCTGGATATGCGAGCTGGATCTTTGGTGTATGAATTCCTGGAGACAATTCTATTCTTTACA
TCGCTGAACAACCTGGACATCTCTAACGAGACGATGGAGTTCTGGATTGACTTTCGAGTGTATGTGTCGGgcaagcacgagcagcgcatGTACGTTTTCG
AAACCTTCATCTCTCGGCTGTTGGTCATTTTGATTGAACGGACACAGTATCCGGAAGGGTTTGAGGCCTTTCCGGAAGCTGCTAAggagcgcttcttctt
gtaccgAAGCGAAGTTCGGAATGTGTTCCGTGCTCTTGCGACAGTCACAATAGTCACCGAGGACAACTTTATTGTTGATGCAATCCACGCGATCTTCCGG
CAGTACGAAGCCGTCGATGCAGGATCTCCTTTGCCAGCGAATGTACGTGGTTTGCTGTTTTACTGGCTATTGTGCTCGTAAAACTAACTCTTGTGTGAAC
TTGTGTATTTAGTGGTGGAAACGTACAGAAGTATACGTACACGCTCTTAGTGCGTTATCAAAATCAATTCGTGAGGAAGATACATCTCTCGTTCCAAGGC
TGTTCGAATACTTGTCAAGAAAGGAGCCCTCCCACCGCGCACTCTCGCGCACTGTCACCATCTTCCTTGGTGTAGCTGGTCATTGGTTTGCAAGACACCC
CGCGTACCTATCAACCTACGCGTTCCAAATCATTTCCAACGGTTTCGAGTCCCAAGATGATCCTGGGTTCCCTTTTAGTCAGCACGGTTTAGAAGACCAC
GTAGGCGCAGTGGCACTCCGGAAGTTAACGCTACGCTGCGGCTCGCACTTCTTCAATCCGCTGTGGATGGACTCACTGGTAAACCTGTACCGCTCGAACC
GTGCAGCAGTAGGCGGACCAACCGGATCATGTTTGACGGGGAACAGTTCGAAGCTGATCGTGGACTCTATTTGCCATGTTCTCACGACTGTATCGTATAA
GGATGCACTCCCTgtggtggaagagctcggTGCGATCATGTTTGCGGACCTTGCAGCACGGTATAGCCAATTGAACGCGGACGACGAAGGCTCGGGCGAG
TTTCTGTGCGAGATGTTCAACCACCTTCTCGTGTTAGCTACGAGGATCCCGATGCAGGTGGACCAAGAGACCCCGCATCCAGTTCTGTGTGTTCTCCAAA
AGCATTGGGGGGTGTTGGAGACAATTTTACGCGTGTACAATAGCTGTGAAGAAGTGGTTGAACGATTCTGCGCGCTTTTCGTGGGCGTTTTTGAATCTTT
GCGGTCTCAAGCTTTGGAGCTGGCAGCTGCCATTATGCcggtgttgctggagcagtttgcGCACAGTCATGATGGCAGCTATCTAAGCGTGATCAAAAGT
GTCATTGGCTgcgctggcgacgacgaggctACGGCAGTTAGTTTAACCCGCGTGATGGTCATCGTGTCTGAGACCTCGATGGCAAAAATTGCGGCAGATG
GTAGCGTTGATGAGCACCCAGGGCTCACCACTGCGCTCTTTTCTTTGGTGGCAACGTGCGGCACCCACCACCCGTCAATCTTAGTGCAGTCAAACCAGTT
GGAAGGGGTGTTGGCGCTAGCACTGCACGCCTTTAAGTCGCAGAACCCTGAAGTTGGAGCAGCGACGCTCGATTTCCTGCTGGAGTTGGGCTCTTTGTAC
GGCCAAATTCTCCGAACTCCGGAGAGCTTGCTTCATGGGCCCGAATTCTCGGGGAAGCTTTTGTTGCACCAACAAATCCAGACGCTGTTCTTCGAGAAAG
ACGTGCAGTACCACGTCCTCTTCGCTCTGTTCAATGCCGCCGCAGGGGGAATGTCGCCGAgcttgatggagaagatcgcagaGGTCGTTCGGTCTTGCTG
GATCTACTTCGGACGGCAGCGCAGCGAAGAGCTCATCTTTAGGCTTCTGTCTGATGGCAGCTTTTTGGGCTCGCAGGTTAGCGAGCGTGCTCGGTCCGAG
TTCGTTTCCTTCATTTCCTCTCCGGGTTGCGTGGACAACCCACGCAAGTTTAAACGCGTACTGAACGCGTTTTGCGACCATTTCAAGCGCAACTTGAGTG
GTAGTGCGAACGCGGAGTCGATGCCTGCGtaagaaagaaaaaaatacGCCGCCTCAGCTAGCAAAAATACGAGGGAAACATGAAAGTGAAAGTGCAAGGG
CAGAATTTGTAAGGGAAAACGATGCAAACCTCCGCAGCTAAAACTTTATCAGTTATAGTGCTCGTTTCTACTGAAACTGGTTACCAACATCCTGCCAGGA
CGTTGTGTTGTTCTGTGTAGTAGCAGTGATCAAATGGCCACTCGGAGGTCGACCACCGTTCGACCACTCCAAAATCTTCTCGGCAATATCCTCTGGCTGC
AGATAACATTGTGAGATCACGGTCATAGCTGTAGCGAAGCTCTTAACGTAccttcgtccacgtggaAAAGTCAGCGTCGGCCATGAACTTGCGGTTCATC
GGCGTATCAATCGTCGTAGGCAGCACGCCTAGCGCTGTCGCATCCTCAGGCAGCTCAGTCCTGTATCAAACAACACAAAAGTAATGTCAAATGCGCCATA
AATCATGGAATCCAATTGCTCAAAACCTTACACAGCACTGGCAATTAGGTGATGCGTGGCCGCCTTGCTCGCCCCATACGATACCATGCCAGGAGTAGCT
TTTAAGGCAGCCGTCGCGCCCGTCAGAACGAGCAGACCTCCGGGTACCAACAAGTGGCTGGCCAAGTATGTCGCTACCACACGTAGTCAAAGCATGCACA
GCGTTAGCTACTCAAACTCGTCCCAGTATGTTTCCCCTCTCTCACCCAGGAAAGCCGATTCAAGATTTTGGGCGTGCATCGTCCCCAAGTTAACGAGTGA
GTCCGCGTCGCGGATGCTGCCTCCCGCCCAGCCGCCAGCAGTGCACACCACCGTGTTCATCTTTCCGTGTCTGTCCATCATATGCACGTAAGTACACACT
TAAGTAGGTATCCACAACAAACACCATCTCCCAAGTTTGACAAACCTGGCGGAGATCTCTTTCAGCGTCTGCTCCGCCTGCTCGAGGGAGTTGCTCTTGG
GTATCAAAACGTTGTCGTTCGCGTCCTCATTCGCCGAGAAGCCCACAGAAGTGACGCCCCAAGACGCACGAGCGAAGTGGTTCACCACCCCACGACCCAG
CGCCCCGGCACCGCcaacgaccagcagcttcttggacaTGATGCAGATTGGTCAATGCATAAGCTTATCCAGTTTTACAAGTGTAGATCAGCAGTGACGC
CTAGGAATAAAAAGGGGTTTTAGCGTCTAAACAATTTCACGGTTTTatcaaggacaagctgcCTTCTGCCGGCAGCGAACATACTAAACGACGTATAAGC
TGTTTAATTAATCTATGCGAATTTCTCCGAgtggaagtcgaagatgGTTCCGTTCGGGTCGGAGGACGAGTACCGCTTGCACGTAGTGTCCAAGATCTCC
TCGAGAGCGTGTGGGCCGCAGTAGAACActccaacttcttcgccagggTGGTTGGCCTTCGCCTCGGAAAACACCTTGTCCCAGTCCGGTCGACCAAAgt
gcgtgagctgcttcgtgttgAGACCGGACACAAAGTCCTTGCCGGTCTGCTCGTGCACGAACTCCTGGAACATCTTGAGCTGCGACGTGTTCTCGCTGCC
CTTCAACGTACTCAAGTACTGGTGCGTCTCGATGATGTTGTCGCGGTCCATTTCCGAGATTTGGTTCATCGTCTCTTCAAACCAACTCAGAGATTCCTGT
CCACGGGTTACCCAGTGGAAGTaaagcttctggatcttgaACGAGCCTGGATGCCGAACGTGGTTGCAGTTTGTGCAGCGGTTGTCTTCCCAAAGGTGCA
CCACGTCCTTCAGGATGGAGGCAAACGGGGTGACACCGATACCTCCACCCACACAGATGACGGTCTTGTACCGGTGGTAATCTTGAGTAGGAGCACCGAC
CGGACCGTCGAGATACATGTCGGggtacagcaccttgcgTTCATGGCAATCCGAGATGACCCGGGCCAAAGCTTTAGTCCAGTCACCGCACACGCGGATG
TGGACACTGATGTAGTTGTCGCCAGGAGCCGACGAAATCGTGAACGGATGCCACTCGTGGGAAGAAACGAGAGGACAATTCAcgaacatgtacatgccGG
GACGGTACACAAATCGACGGGGTTTCTCCATGAACAAGGCTACGGTGCCGTCAAGTTCCATGGCTTCCATGATGCGAACGGGAGCAGCAAACATCTTGGC
ATATCGGAAGCGACGCTCGATCAGATAGAGGAGGAACGGAGGAGTGATCCAGATGTACGATGAGCAACGAGCaagccacgaagctgcaccGTGGAACGAC
AACACGATCAAGAAGGGTCCGAAGAGCATGTGCGAGTACCAGAAGAGGTTGAACTTGCCCTGGCGGAACTTGGGGATCGCAGCGAGAGGAAACGAAATGC
AAGTGATCACCAAAAGGATGACACCTGTCCACACTGGAAGTGACTGAAGCATCGTCGTGAAGGGAGGGCGTTCACCGTTGACGAAAGAAGACACATGACG
CTGGACGAAAATGGAGCGCTTGATCTCTTCAGGAGTAGCGATCAGGTACAGGTAGACCTCGTTGAAGATGTGAGCGATGGTGTGGATGAGACCAGCAGTA
AGCAACACGCTTCCTGAGATCTTGTGAAAGGCGATGTGATCATCAAAGGGGATGTAGCGCCAGAGGAAGCGGCTACGCTTCATCACTTGAGTGATCGAGC
GACACATCGGAAGTAGCACGAAGACACAGTTGACCATAGCTACTTGAGCGTTTGCTCGGGCGATACGAAGACCCCAACCGATAGCAGGGTCCACGTCGTA
GGAGAACCACTTGACCCAGAAGGCGATGTTATTCAGTATGGCGTACACCAGAAGCCACCAGATGCGGAGCTTGTTGGCGCTGTACCAGGCTCCAAACTTG
CTCTTAGGACGGATAGGTGCCGTATAGACTGGAGTGGACTTCTGGAGGTTGTACGAGTCGTTGATGTAGGGGGCGAACACCGTcttgaactgctcgaacG
TCATCGACTCGTTCTTTACCTGAGCCTTGCGGAACATTAGCTTGGCCACCGTCGTGAAGTCCGTACCAACCACGTCGATGTGAGCGGCCGAGAAGTTCGA
CTCCAGTAGCTGGACGATCTGGTCCTCGATCACGTATCCAGAGTTGTCTGGGTCGAGTGTTTCAAAGATGAaacgcagcttctcctcgacgTCGACTTCG
AGGTCCATCACAGCGTCGATTAGGATGGCGTTACCATCGATTTCACCATTGCCAGTGGCGTAGCCGTCAAACTCGTTGCCGTTTACTTCGAAAGCCTGGG
AAAACGTCTCACGCTCAATGTAGCCACCTTtgctggtgatgctgctCATAACGTCACGAAGtgcgtgcagcttctccatgggGGTGTAGGCCGGGTCGTT
GCTGTGAATGGCGTGCTCGTCCATACTCATGGCCACGTTGTATTTCTGCTCGAAGTTGCAATCCCCAAGGACAGGGACCGACACAACGTCGGTGCCAGGC
TGCGGGCCGTACCGGGAACCAGCGAACGACGACAGGTTGGACGCGCGCGCGAGACTCTGCCGCACCATCGAGGCGCCCAGCATGGCCTGGACATTCGGAC
GGCGACGCTGGTTGCCGCGACTGCTCTTGCAGTTGGCGCTCATCGTGGCCGGGCCGCGTCCGGCGATGtgtgtggtggtggagttcATGTTGATGAACtg
gctgctgtccatgaAGTTGGACTTGCCTGTGCTCTggaacgtcgtcgtcatgcTAGGGTGGCTGTTCATGGGCGGTGGTGGGGGCGGCGCAGGCGcgcgc
ttggccttcatACTGCCCTTCCTGCTGTTAGTCCTGCTGGCCGTCCGCTTGCGGCGCGCGTTGGGCGACGGCGTGGAGATGTCGACGAAATGCTGTGTGT
TTTGTCCCGGAGTgatcttgagctcgtccgcAGGCGTGGCCTGTGGCAATCCGTCACCACTGGTGTCTCCCATCTGGAAGGCGCGATTCTGGCGGTCGCG
GTTCATGGTCCACCGAGAGGGGCCTCGTGTCCCtgcgaaggcgaagaaagcgaagTGGCGAGTGCAAGGGCGCGCGTGAAGCGATCACGACGATGCGGTC
TGTAGAAGTCCTAGCGCGAGTGGCCTCGGAGCGCCTCTAGAAACGCGCTGGCACCTGTGCACAGAGAAAACAGGCAGGTGGCACTGCCGATGGCGTTGCA
ATCGCAAATGGCGAAGTGGTCTCCGCGGCGCTGGGGGCATTTCATGGCAGCACCTGGTCGGGTGCCGTGCCCCGGAGATGACACGTTAGTAAAGTGCAGC
CCACCGAACCGCGACATCTTGGCGTTTGTATGGAATGTTCTTTTTCTCGTCTAGATTCGCGCTGACTCTGCAGCGGGTAGGGGGAAAACGTTTTTGGATC
CCAGCTGGCCGATGGATCAAAGCCGTTGGAACTGTTCCCACTGACGAGGGTCAAGTCGATTCGGCTTCGACATCTTTACAGTTGAGCTGCAGTTCAGCTC
AAGAATCCGGCATGGAGCTCGCTCGCTTGCGGCGGATCGTAGGCGTGCGGGGTGGCACCACCAGCAGGGAGACGGCTGTTTTGAAGAGCGCGCCGTGTCC
GCTCAGCTTAATGGCGCGAAGGTTCTTGCTTCACCGGCCACACTAGATATCTGAATCGTTGTCGCGAAAGGATGGCTTTGCATGCCACCGACCAGATCCT
GGTCTTGTGTGCACAAACTTGGGATCCATGCTGGCCCACTGCCACTCGTTTGGCAGCCGTTCCGTTGGTACAAGTGGCGGCCTAAAAGCGCATTTGACTA
ACAtggttcttcttgaagtaaTTTGTTAAAGGGCTGGAAATACAAATGTAGCTGTTCAATGCGTTTGGGTGGGACAAATTTATCAGTGATACGCCTTTGG
CAGTGTTATCTATTCGGAGCGGAGACCCAAGCAAGAATGTGAAGAACGACAACGCAAATATCCGTCATTCACGACAGACATTCGCGGAAAGTCTCCTACT
GTAACATCCACGCTAAATACCGTACGTTGCTGCGGCATGACGAGAACGGTTGCAACTCGCATTACTCAGAACTGCTGGGCCAACAGCGATAGGGGAACAC
CGCCGGAAGCATTGCCACAAGCTTATTAATACATGAACGCCGGTAAGCAACAGCGTTAACGCCAAGTTGGTCCAGCTCGAGATTCTTCCTGCGATGTGCT
GCCCGCGGATGAAGCGGCAGTTTGGCCCCAACTTGGGGACAGTCTCCCCTTCATGGCAAAGGTGGCGCCGTACGTAAGACATGGC