Description :
From Genome Similarity Track
Location :
scaffold_60:10778- 19735
Sequence
8957 bases(100 bases per row)
AGTTCTTCCGTCGGTCGTATATGACAATCTTGATGGCGATAGAACAGCAACCCTGGTGACTCCGAGCGCTGGTGTGCTCGTGGCACACATAAACTACCGG
ACGGTATATCTTTCGCCCCTCTGGTATCTAACAACAGGACAAACTAATGGATAGATCTTGGTCCTATGATATTGCAGGACCCTCGATACTACACTGAAAA
TGTATTAGAGTCCAGGCTCAACTATCCGAGTACGTCGATCACTGTTGGGTACCAAGCTGATAAATGCTGACACTTATTATTAAAGCCTCTCTGACACCCT
ACGCGAAAATATCATATGCGTCAAAGCCAATATCAGCTACAGCGTACAAAGCTGGGCAAGGGGCAACATTTCTAAAAGATTTCGACGCTGCTGCTGCACC
CATCGAAAGTGATGGTTTCTGCGAGCGGGAGCTGTCAGCCCTGGGACTTTTAGTAAACACTCAAAACGACATTTGCGGCAGGTTCAAGCAGGTTGATACC
AACGTAGGGTTTTTATTGCAAGTGGAATTCGTGGAGCCTAGCGCTGTCGCTATAAACTGGTCGTGGTACCTGGGATTACCTTTTCGACTCGGTAATGGGG
CCGTGGTTGTTCTCGATGGAACTATTGTGCAAGATTTAATGGGAAAGGCCGGCTACTGGAAAAGTGTTCTCTCGAAAGCTACCCAGGTGGACATGAAAAT
TACGCCCGGCTTTCATGTGTTGAAGATTTATGGACTCTCCATGAAATTTGAACCTTCCGCAGTGTACTTCAGTCGGGATGGATCCATACCTGCACTAGCC
TCAGTGTCTACCATTGTTGGTGAGCTGACAAAATGGTCGCCATTCGTCGCTCCCGATCCCACGATTTCGGCCACGCTTACAACCGAACAAGCGAACAAAG
CGAGCAGTGTTGGAAGAGGAGTATCCGTCTTGCAATTCCAGAGTATTCCAATTGATGGGAGATTTGCGTTACACCTAGCGTCTGTGTCAACAACTGATGC
TCAAGGTGCCAAGACTAACACGTCATCGCTTGTTTCATTTTCATTTTTACCTACCACCTCGTGGGCAAATGCCAAAGCGACTCAAGTAGCTTTTTTGACA
GCGGTTACCACGCAATGGAGTGTAATACCTGGATTGACGCTATCCCTTCCGTATTACTCAAGCGGAGTGCTGCTTTGTTCCTTTACGGGGAGATTCATGG
TGGAGAAAAACACAGTAAAGACCTTTCGTTTAGATCTCGGGTTTGGATCCAGCTCTATACCCCCAGTATCGCAGTTCCGCTTGGACGATACGTTTTCCGA
TCCATCTGGGGTACCACTCGATTTTTCCTATTTCGCCAGCGTTTCACCAGCAAGTACAACAAATCTTTCTCTGAATTATCAGTACCAAGGAACAAAAACA
GGAAAAATTATCGGCGGCAGAAGTACGGCAGTTTTCGTCCCTGGGGCTTTGATGACCACAGACACGTTTGGTGACTCCACAATTTCGTTGGCAGCTACGA
TGTTCTCGAAAGTAGTGAATCTTTCTACCTCAAGTACTATAATTATACGTGTTGCTGGAGCTATTTGCCGCAATTCGGCCACTGAAACATTCCGTGTGCG
CATTTCGAAAAATGGAGATCCAGTTTTTGATGGTGATTTCTCTTCGATCTCTGGAACTGTAGCAAATGGGACTTGTGAACCGTTATCGATGCATTCTGTA
GTTGATGGTAACGCAGGTCAGCACACCATTGCGATTGACGCGAAGTCGTCAACATCTACAGGATTTCGACTAAAAGGTGTTCAGCTACAAATTGTCACTA
TTGAGAGAGGTGCTTTGATGTCACAGGAACTTTGCCAATCTCGTTGCTCACGTCATGGTCTCTGCCGACTAGGGATGTATAATATTGCAAAAAGCACGTG
CAACCTCTATATGCTTCGCAACGCTTCTGCAATGACAACAGACTCAACACGAGTTACTTTCGTGAGAAATCAAGAACCAACTCTTTCGGAAAATGCTTGG
ACCACCCTTCGGAACACCAAATGGACTCTTGGCCAGAATACCTCACTCCAAGTTACCAGTGACTGCTCCAAGATTTACAAACTAAAAGATCGTTGTCGGT
GCATTTGCAAATCATGTAGTGACTGCGTCGGGTTCATGAAAACTGATGAAACGTGTTACGGAATCACAGCAGCGGATCTTCGCCAAAACTTACAATTCCG
GGCATACAATGTTTCAGGTGGAAGTACTGTTCACTTGAATATGCCTCAGACTTGCCACGCAATCAAAGACGACGCGCCCAATGCAATGAGTGGGCGTTAT
GCTATTGCTACGTCTACAGGGATCTATGATGCCTTTTGTAACATGACGGCTGATAGTGGTGAGGGTTATACGATGATTCCGTGTGATATGGGTACCACCG
ATATCGATTGTCGAAGCAGTACGGATCCGAAGGATAGTGATAGCTGTAAGGCGATGGGTCTCCAACAGGTTGTGCCGCGATCGTCGGGACACCTAGTATC
TATGCATCGGAAGTACGGTTCATTATATTTCTCCACGGTCCCTGGAATTACCAATGCCTACGTTGGTAGTACCGTGAATTTACCCAGTGATGAAGATACT
GTGTTAGATTGGACGTCGCTTGATGGCGGAAGATGGTGGTTACGTGACAATGGTAGCAGCTGTGATACGATCTCCCCGGCAAATGCACCAGACGGGAAAA
GATGGCTAGGGATGCATTCCTCGTTCAATGGACAAAATGTGCTTGATGGCGTTGACTTAAGCTTTGATCCGCGAGGTTTAGTTACAACAAAGTATCTTTG
TTCAACTAACGATATTGACCCTTCGATATCGTGGATCTTCGCTCTCCAAGATTCATTTGTAGGAAGTGGTGACGACAACTTGTGGGTTCCGTCGTGGGGC
AGTACTGACAAATGGTACCAACTGTGCCAAGGCATAGTGATTCTTGGTGGGAAACCATTTGCGCGGCCAGGCTCTTCGGTTGCTAAAAAGGTGGCCCCGA
TCAGTAAGGGCGACAGACCAACAAATGTCCGAATCAAGTTTACGTACTACTTTGTGTTCGATCCCCTCTACTGGGTCACGCTTCTTCTCAAGAGCTCAGA
GCCTAAAACCATTCGCGTGTATCTAGGTTCTCAGCTTGTTCGGCAAATCTCAGTTGACACATCAGTGACGTACGCGTGCTATGGACAAAGCTCTACTTCA
CCCTTACAAAAATACTTTTACCGTGGACGAGAGCGCTTTGTAGTGAGAGGTTTTAGCGGCGATATTACCCAACTGCGGATTGACACCGATTTTGGATCTT
TAAATATTAGTGCTTTCGGGATCGATGAGGTATCTATGGAGATAGAGTCTTCGTTTAAGACATCACTTGGGTTATCGGCAGCAAATCCAGCTGTGTCATG
TATGCACTTGAAAAGTGAGCGACTAGCAAATGGAGATCCGAATCCAGACGGGCAATACTATCTTCAACTAGATGCTAACAGTGATCCAGTTATTTTGCCT
TGTTCTGATGGTTGGATCGTTGCACAGCGTCGCATCAATGGTAAAACAACTTTCAATCGGAATTGGAATGAATACCGTGATGGTTTTGGTCTAGGGTCCT
TCAATGAATGGTGGATTGGAAACAAGGCTATCGCAACGATAACAGAACGAGCGACGGAGGCAATGGTTGTAATATCCAAAGATGGTCTGTCTGTGAGTGC
GTCATACACTGACTTTCGAGTTGCAAGCGAAACGGAGAAATACCTCCTCATAGTGCGAGGGTACAATGCATCAGCAAGTTACGCCACAGATGCTTTAACG
CCTCTTTCGAATACGTACTTTAGCACGCCCGACCAGGATAACGATATGTCTGCAAGCGAGAACTGCGCCAAGAAGAGTCGGAGCGGGTTTTGGTATGCAG
ACTGCCTTAGCACTACAAGATCGGATCTGAATGCGCCGTTTGAGTCACTTCCCATTTGCACTTCCTACGCTGCATGGGCGCAAAGTTGGTGTCAAAAGAC
TGGAAGTATAGTGTGGGGTAATGTTGATGGCTATGATTCCTCTGCACTACTATTTAAACCTGACCAATGTAACCCAGGCTACGTAAGCTCAGCGACTGGT
GACTGTACTCAATGCCCCGGGGGCACATATTCTGCGCCACATTCACAGGCCTGCACTGCCTGTCCTGCTGGCACCTACAGCCCTACTGCGGGCGCGTCCA
GCGTTGTGTCTTGCCTTCAATGTCCGACGGGTTTCAAGTGTTTGCCCAGTTCGGTAGCCCCTGTGAAATGTCTAGCAGGCACATTTGCTGAGGCTGGGTC
AAACGAATGCCTAACGGTACCAGCAGGTTATGCAGGTCCATTTGATGAGATGTCCCGAGCTGCTCTCATACCGTGCATTAACGGAACGTTCTCTAAGCCT
GGACAACAAAGCTGCAGCACCGTACCACCTGGATTTTACTGCCTGCACAGTGGTGTTGCTTGTGGTTATACTTCGTTAGCTCCATGCCCCTCAAGAAGTG
TATACTGCCCTGAAGGAAACACTGGCCCAATAATTGTACCGCTTGGATACTACTCTGTCGGATCCATAGTAAACGATGAAACCTCCGCCATTTTGCTGTG
TCCAAGAGGATATTACTGTCGCAGAGGCAACAAATACAAATGCCCTCCAACACGGTTCGGCGACCAAACAGGTCTCCATAATCCACTTTGTTCCGGTCGA
TGTGCAACTGGATGCGTGTGTAAGGCTGGCAGTAGCAGCCGATGCCCGGATAGTCCAAGTAGTGCTGGTCAAGTTGCGTTATCGCCAGCGTTAATCTCAT
ACACACTTGCATCTTTACCGAAACAGCCCAGCGAAACCAGTGACGCTCTTTTACAAGGTGTTATTTCAGCCACGACTAGTAGTACCGCAGTACTGCTGGG
TATTTTCGAGCTTCGAGAAGTCAACGCAACATTCTTTAAGATGGGATGGTCTTCTGGATTTGCACACAACATCTCTATTTCGTACTTTGAGCAATCAGAA
AAGAACCCGAAATACGAGTTCCAACTTCCGATTGCTGGCTTCGATTGGGGGGCCATGGTAGTGTTGGACGGGAGTGTTATCGTTTCTCGATCGAAAGAAA
GTTCTCTCACGTTTTCATTCATATCGTCATGGGGTCAACATTCTCTGTCGATTATCGCAGCTGAATCTCAGTTCACAGTCAAGAGGTCAATTCTTTTCCG
TAAAACGACAGATTCTAGCTTCAGCATCTTACGGTGCGACCTATTGGATGGACAACCTATCTCGTTACAAATTGATGTCACATTGTGCACTACGGGGGCT
ATGGGCTGCTCTCGATCTGCCAAAATTAATGGAGAAGTGGCTAGAAATCTTGCTCAAGCCCCGAATTTCTTGGACATTTTGGTGTACTCAGCAACAGGTA
TCCTGATTACTTCTTTTAGTACTGACGTATCATCTACATCCAGTTATATGCCCACATTATCAGTGGCGAATGCTGGTGGAATTACAATTGTTACAGGCGC
AAACTTGGGGGCAATTCCGCTGGCTTTACGCAATTGGATAGCTGCGTATGGTATTTCTCAAGTTGCTATTGAATCTGCATCTCTTGGGTTTATTTTTGTG
GCCATCAACGATAATGATACTTCTGCCATTTTTGACGCAATTGGAACTGGATTGAGCTACTACAGCTCACAGTTAGTACTTCCGCTTCCGCAAGCACTTT
CTTACTACAACTTTATCAGTGTTCCAGCAGGATACTATGCTGTCCCCGAGGACATGTCAAATGATCGGAGATACGAACTCAGAAAGTGTCCACCAGGGTA
TAGTTGCTCAGGTGGTGTTCGCAGACTAGCTTACGTCTTTCCAGCTACAATTTGTGTGGAGAAAATGCACACGTTGTATTTTGACGAAAACGATGCCGGA
TTTGTGTCTAGCAACAGTTTTAATCTTGTTGCTTCTCCTCCTGGCCTGGTGTATCAGCTGGAAACCACCGCTAAAAAAATATTTACGCTGGATGGACAAA
ACCACGTGCAGCTTCTAAAGGCGTTAGATTATGAAGCGCAAAATGTGTACGATTTGACGCTACTCGTTCAAGAGGTCAATGCTGCTGTGCCGTACGCAGC
CTGCCGAATTCGTGTCAATGTGATCGATGTCAACGAAGCTCCTATCGTGACAAATTATGGCGCTTCTCGTGAAATAGCGGAAAATGCCGCTCGAGTCTCA
CTTACACCTGTGCTAAATGTTGCTGATCCTGACATATACGATTCTTTCACGTTATCTATTTTAAGCGGTGGAAATGGAGCTTTCGTGATCGGCCAGGATG
GGGCCATCGTTGTAACGAAGCCACTTGACTTTGAGGCAACACCCCGTTTTGAATTGAATATCGTTGTCAGAGATGCAGGTGGGTTGGAAGGACACGCTCG
AGTTGTCATTTTAGTGCAAGACGTTCCAGAACCGCCGGTTTGTGCTTCTTACTCGTTTAGCGTCCCAGAAAATGTGTCAGTTGGAACTACTATCGGGACC
ATGAAAGATCATGTTTTTGACCCCGATTCAGGAGATTACATCACATTCCGGTTAGTTTATCAAAGCATACCCGACAGCCTAGTTCTGGATGTAACAAGTG
GCACAGTGAACTTGGGGAAAACTCTCAATTTTGAAGTCCAGGATACTCTCTACTTCAAAGTAAAGTTTACAGATAAAACGGGGTCCCAATGCATATGTGA
CTACGTCATTGGTGTCACAGATTCTAATGACGCCCCCGTTTTAACGAACGGTGTATTTCGCGTTCCAGAAAACTGTGTCGAGAATGATTGCTTAGTTGGA
AATTTGGCTGATTACGCGTTTGATGAGGACAGAGGCGAGCTGCTGACATTTACTATGGTATCCAGAAATGACATGTTTGCAATTCAAAGCTCGCAGCTGT
GGGCAATAGGAGCTTTGGACTTTGAAAAAAATCCTGTGTTTAACATCAGTGTTTCTGTTGATGATGGAAGAGGTGGGCATGATGTGGCTCTGATGACGGT
GCAAGTTGTAGATGTCAATGAGGCCCCTACCGGCTTGACATTTACCAAGCAGGTTAATGAAAATCTTCCTATTGGAACTGTTGTTCACACATTCGAGGCT
TCTGATCCTGAACGAGATACTCTGATGTTTAAGATCGTACATGCAGCTGCAGCATTTACGGAATTGTTCGAAGTTGCAGGTGGAAATTTAGTGACAAAAG
CTGATATTGACTACGAAGTTTTGTCAGTCCACTCACTTCAAGCTAACGTCAGTATTTGCGATCCATTCCAATCGTGCACTGAGGTTGGACCTAACAAAAT
TATCATTATTGACGGCCCAGACGCACCTGTTATCGAGACAGAAATCAAGACTCTTTCTATTCCTGAAACAGCAACTATTGGCACAGCTTTGGATATTTCT
CTTACTTTCTCGGACGAAGATACTGGACAAACCGCACACCTTGTTTATTCAATATATTCAGGCGACCCCCAACATCACTTTGAGATATCTGAATCAACAG
GCGAGGTGAAAGTGAGATCGTCTCTGGATGCAAAAATTATGAGCGACTATACCCTTGTACTGCAAGCTACTGATGCAGATGGGCTTAGTGGGGTTTCGAG
TCCGATAGTTATTGCTGTGGAAATGGTACCTTCCCCACCGTATTTCGTGGGAGCAAGTTCATCCGATGCCGATTACACTGTTGATGTTAGCCAGCTAGGT
GATGGTTCATACGCGAGTGTTTCGTTGCCTATAGCTGACCGAGATTCAGGGCAAATCGGTGGGACCTGTTCAATTACTACAGGAACCGATAAGTTTGTTA
TCTCTACCAGCAGCGACGGAACAGCTTGCGAGCTGTCAGTCCGCCGCGATGTTTACATTCCAGACGACGAGCGCATAAGTGTCGTTCTACGAGTAACGGA
TACAGTCGATACTTTAACGTTCAGCGAAATTACTGTGAAGATACTGTCTCGCAACAAAAATCACCCCCCTGTGTGCGATAGCATAGGTACACAATTGTTA
GAGAATTCGCCGTATGGTTTTGTCGTTGGTACTATCAGTGGAAGGGATCCAGACCCCATCGATACGATATCATATTATGTTGCTTCTGGCGACGATAATG
ACGTATTTCACGTGAATTCAACAACTGGCCTAGTTACGGTGGGCACCACTTCACCTGATTTCGAAACGAAGAACAAATATGCGCTACGAATTCTGGTTCG
AGACGACGCTGGAGCTCCACTAAGTGGGTTTTGTACATTTTACGTCGACATTATAAATGAGTTGGAATCCCCAGAATGTGCTAAAACTGTGTTCATAAAA
TTTCCTGAAAACGATGTGATAAATTCTCTTATTGGAGATGCTATCAGAACAAACTGTATCGATCCTGATACTGGTACGAGTGATATTACGCTGTTCCGGT
TTGAAATTGTTGACGTCAACGAGAAGTTTGCAGTAGATCTTCGATCGGGTCAGATAACAGCAGCACAAGTTCTTGATTACGAAGAGCAGGCGTTCTACAA
TATCACTCTTAGAGTCCAAAATGCGCATCGACCTTCAAAGAGCACATTTATTGGCGTCAACATTGACGTGATCGATCTAAACGACCCACCTCAAGTGATA
TTTAGACCTGATTTACCAAGCTCGAAATTGTTCGAGGTCAGTGTTCCGGAGACAGCTACTCCTGGCACTTTAATTGGCAATGTTTTGGTGTATGATCAAG
ATATTTTCGATGTATGCACGGTATCGCTGCTAGATTCCTCATCAACCATCGGACTCAGGCCAGTTAACACTACCACATACTCTCTGGTTTTAGCCAAGCC
TTTGGACTACGAGACACGCTCCGTATACTCTATTCAAATAACAGTTTTGGATCTAGCCAAAACATCGGCAACAAAAACTATTGACGTTGGAATTGTTGAC
GTTAACGAAGCGCCATACATTGAAAGTAATCAGCACTTCTTCATTGAAGAAAACTCA