Description :
From Genome Similarity Track
Location :
Scaffold_808:10774- 12343
Transcript NameFunction/comments
Phyag_g8150Folate-Biopterin Transporter (FBT) Family

Sequence
1569 bases(100 bases per row)
GAATGGCGCGCTACGGCAAGGCTCAGCTCCTCGCCTTCTGTCTATGGAGAGTGTTGGTCTCATCTCGCAGTACGCGGCCGTGGGCCTGGTCTTCGGCGTT
CTGCCCAGCACCATCACTCCGTTCCTCACGTACTACCTCAACATGGAGGGCACAGCCACAACCTCAGCACGAGCACTGATCTCCATCCCCTGGAGCTTTA
AAGTCTTCATCGGCGTGCTGTCCGATTGTGTGCCGCTCTTCGGGTACAGGCGGCGACCGTACATGGTGTTGGGCTGGTCTGTGACGGTGTTGTGTCTATT
GATCATGGCTGCGTCTCCTCTAGAAGAACCCTATTTCCCTGACCCAACAATGAGAAGCGTCAAACCGACCGACTACtcgctggagttggtgcagtCGCTC
AATAAGAGCGCGCCCAGTAGTGGAGCCAAGTACATTGTGCTCATGATGTTCGCCACGCTCGGATACCTGTTTGCAGATGTGGCAGCGGATGCTGTAGTGG
TCGAATATGCTCAGCGTGAGCCAGAAGAGACGCGGGGACGCACCCAGACGGCAATTTACACGGTGCGCACGTTGTTTAACGTGGTAGCACAAGCTATCAC
GGGTTTCGGACTGAGCTCGCCTGACTATGGCGGCAGTTTTGACTTTGGCATTTCGTTCCCAGAcacgatgttgttgctggcagTATTTTGTCTGCCTGTG
ATCCCCATGACCTGGATGTTTGTGCGTGAagaggtggtgaaggaacGGCCAACGTTTAAGAAGTATATTGGCGAGTTGTGGGCCGCCATCCAGAGCCGAG
CAGTGTACCAAGTGATCGCCTACAGCTTCTTATCGGGTGTGTTTAGTGGTTTCACCTACGTGGCACAAGACCCGATGACGTCGTACTGGGTGCATGCAAC
GAGTTTCAACTTGAGTCTTAGCAGCATTTTTGGCAGCTTTGTGACGGTGATCACGCTCACGTTGACGGGCAAGTATGGACTGCACTGGAACTGGCGGACG
ATGCAAGTGGTCACCATGGTGAGTGTGATCGCGCTCGACGCCATGTGCACCATGCTGGTGACGTGGGATATTGTGCGCAAGCAGTGGTTCTGGCTGGGCG
TACCGATTGTCGAGGCCGTGCCGGATGCCGTAGGGTTCATCATCTCGacgtacgtggtggtggagcttgcAGGGCACGGCAATGAAGGAGCAATCTACGG
TCTGTTGACCACAGTGAGCAACCTAGGTGGGCCATTTGCCCTCACTCTGACGAAGAACGTGAACGCTGCTTTCAAGGTGTACAACGAAGACATTTTGAAC
GACACGGGCGAGGTGCGTCGTGACGTGACCATTACGATCTTGATCTCGTAcgtgatgaagctgctggcgctgatCTTTCTTCCGTTGCTGCCTCGCCAAA
AGGCGGAGGCGCAGGCTCTCAAGAGAtcaggcggcagcagtcgACGTATGGGCGTGTTTACAATATCTTACCTGTCGTTTGCGTTGGTATGGGCGATTTT
GACCAACTTGCTTGGCATTTTCGAGAGCACGCGATGCTGGGCCATTACGGGAGGCTGCAAGGAGTAATC