Description :
From Genome Similarity Track
Location :
Scaffold_36:1077- 2543
Sequence
1466 bases(100 bases per row)
TCCAGCTCCTCAACATGGGCAAGTCGAACGATGAAGTCGATGCCGTTCTCAAACGCATTCTCCCAGCTTAGGTCGGAAGAAACTTCACGTCTTTCAATTA
GCCTGTGTAGTTGGCTCAGGTATTTTGGGCGTATGGGTGACTTACTACTCCCCGTAAATAACAGCTCTCTTAATGATTCTCGTCTCTTCACACCCTCGCT
TTTGCTTGATGGTTCAGCATTGAACAATAGTGCTGATAATCTTCTTTCCTCTTCAGCGTCGGGGATACTTGCATCATCCCACTCGTCCGATCGGTCAAGG
CCAATGTTATGGAGAAGTACACATGCCGGGATGTGGTTGTTAACGAACTTAAACTCACTCACAGTCTTAAGCTGCGTTCGAATGCTCTTTAACGACATCC
ACCGATTTTTCCAGAGACCAACGCAGTTCTCATTTAGGACCCGAGCACTCGACACCACCTCATTGAACACCTTGTTGTCAGGATGGTCAGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN