Description :
From Genome Similarity Track
Location :
Scaffold_879:10769- 11852
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_879-fgenesh-gene-0.2F-box protein

Sequence
1083 bases(100 bases per row)
AAGAGAAAAGGTGGTAATGCAGCGGACAAAATCATGCAGCTCACCAACATGCTGCGCTCGGAGGAGGCCAAGCTCAGTCAGCAGCTGCTCATCGCGAGCG
AGAAAGGCAACAAGCACGCCGCGTACCTGCTGCTGCACCAGGGCATCGACAAGGACCGCTGCAAGGGAATGGTACAGTGTACATCATACTGTTCCTTACC
CTGTCTGGCTAGTTCTCACTCTATTACATGCATGGAAACATTTGTTGCAACAGGGTGGGTACTCACCTCTCCACTATGCCGCGACAAGAGGCCACCTGGA
GGTGATCCAGCTGCTGCTGGACTTTGGCTGGAGCATCAACACTGCGAACGACCTGCGTGAGACGCCACTGCACCTCGCCGCGTACAACGGCCACGCGCCC
ATAGCCGAGTGCCTGCTGGATCGCGGCGCAGACGTGAATGCGCGCAATAGTGACGACGAGACACCGCTCTTCTACGCTGCGCGCAAGCACCAGTACCGAA
TCGTCCGGCTGCTGATCCGTCAAGAGTGCGACCTGCTGCTCAAGAACCGATTCGGCGATGTCGCTGAGGACGAGGCCTCGCACGAGAAGACTCAGCTGGA
GTTCGCGGTTGGGAAGGAAGACGCCCAGCGGCTCTACTCTGTGGAATCCAAGACCACCAGCAGTGCGCCAACCGTACTGGGACGAGAGCCAATTGGGAAA
CCAGTAGCCTCTTTCATAGCTGTCAGCAGCGAGCAGCTCATCAGTCAGAAGCAGCGCGAGCACATCCTGTCGTTCCTGGACCTCAAGAGCCTCTGCCTGT
CGTCCCAGGTCTCGTACCGATGGCACCGTGCGGCCGACAACCCGACGCTATGGCGCAAACTGGGTGTGTCGCGCTGGGAGCTGCTGCTGAACGCCACCAT
GGGCATCGGCACAGTCTCGCCCATGAGCACGATGGGCGGCTTCCACTTGGACTTGTCGGCCACCAGCAGGTGTGCGAGTCGTCGCCCGTCGAGCTGCGAC
CAGGGCAACAGCAGGTTCGTCATGCCGAGCGTCAAGCGGAAGAGCTCAATGCACTTTGGAGACGACCAGCGGCCGCAGACTGC