Description :
From Genome Similarity Track
Location :
Scaffold_13:107678- 108692
Transcript NameFunction/comments
Aphas_H257_05679dynein light chain

Sequence
1014 bases(100 bases per row)
CACCCCCTCCCCATATTTGTATCAAATCGACAATAACTATCATAACATGAAAAGGCGGCGGCAACAGAATGAGCAGGGGTGCGTACCATGCCGCTGACGT
AGAGATGCTGCTGGGACTCGTCGGCGTAGCAGTTGAGTAGGTCGCCTTCGACTTTGATAAAGTAGCGATTCCATGCATCGACGTCGGCCGCGGGGACTCC
ATCGCCGCCGCCCACTGGATTGTTCTGAGAGGAAGATGGAGCATTCGACGAAGACGCGGCGTAGTGGACGTGGACGTAGCCCATCTTGATGGGGTTGGGG
CGGTATGCAATCGGAGAGTGCTGAGTTGCGTTGTTGTTGGACGAGGCGGCACTGTTAGTCGACGATGAGGTGTCCATCATAGACGCCGATGATGTATGGA
GCTACGTCACATATGAGACAAAGGAAGGGAGACCTATCGATGGAGAAGGAGGCAAGTACCAACTGCAGAGATGCAGACGACGACGACTGACCCGCGGTCG
TGGCGCGGGTCAGCAGCGCAAACCACGCGTTGTACGCGACATTGGTGTCGCAAATGAGTTTTTCGTCCCGCCGTCGTTGGTTGTTGGACTTGCAGTGCAG
AAGCAGGCCGTTCGGTTCCGACGGCAGCGGATGGACCGACGCCACGTCCAGCACGCCGCGGGGTGCCCCCGAGATGTCTTCGCTGTCATAATAAGACAAT
GTGCTGCCAGACAGCGCGAAGAATCTACCAGAGACCGCATGACGATCGTGCGAAACAAAGGGCGTCCATACCGCCGATTCCACGTCTTCAAATGCGCTTT
TTGCTTGCGCATCCACCCGCTGAGGACAATCTATGATATCCACGTCGTCAGTCCTCAAAGCATTCACCATGTCGGCATGCCTTGGGCGCATTGGACGACG
AAGGAACCGTGGCTGCCGACTGCTGCTCCTTGCTCGACCGATGCCGCAAGAGCGACGCCATCTTGTGTGACACATCCACCGTAACATCCGGATAGATGGA
AGTATGTATCCGGA