Description :
From Genome Similarity Track
Location :
Scaffold_385:10764- 11904
Sequence
1140 bases(100 bases per row)
GCCATGGACATTCCATTGCTCGATCTCAAAGCCTCTTATCCAGGTCCTCTGGAAGTAGGCCCAGAAGCTTGCCCACTTTCGTTTCGAATATGGGAAGTTG
TGCTGCACGCATCTCGCTCGAATCTGGCTCTTCACGTACGCGACTCCTTGCGCGGCAACTCTGCTGGGCGGCAGAACCGTGAGCATATCCAACACCTTTG
GCTTCATGGCGATCTTGATCTCGGGCCTTGGGATGCACAAGAGTTTCATTCTCCTCAGGCACGCCTGCTTGAAGTGATAGAGGCAGACTATAATTTTGAC
CTCTGGGAATTGGCACCACACAGACTGGATGAGGGCAGGCTCGAAATCGCACACCACACAGCAGGCCGCACCTGCTGCTCACCAGCTTGCATGATGAAGT
GCAGCACGTTCCAGTACATGTTCGCGGTCTTCGAGGTGCACAAGACGTAGAACACAGGCACATAGAGCTTCGAAGACCATCAAGATCACGCACTGCTTGA
AGCCCTTTTTTTGGCACACAACGGAACGTGCCGTCGAGGAACAGAGTCGTGCTTTTGTACTTGACGAGTCCAACCAGACTCGGATGGGCCCAGCCGATGA
GCTGCTCCAGCTTGCTGTGAGGTGCCTTGCGGTTGTCCTCAACATAGCTGTGGTAAAACTGGAAGAAGAACAAGTCCTCGTGTTTCACCATCGCCAACTT
TCCAGTCTGGATTTGCGCAATCAAGCTGCCGCCATAGTGGTTTTGCCAAGCCCAATACACTCGTCGCTTCACTTGGTCGCGGTCGAGGCCCAGCACCGCA
GTGCTGCTTGTCGATGGGTAGAACTTCTCACTGACTGCGACCCATATCTCCTCAGCCAGCAAAGCGAGGTTGTTGACTGCGAGACGATCAACTTCCATCT
TCATCGCTCCAGTAACGTCCGTGGCTACTTGAGCTTCCACAGCTTGCGATCGGCAAGTGTGTGCAACGAAGTTGTCGTAGCTCATGGACTCCGCAACGAA
CGCAACTCGGCCACGGCATCGCTCCTTTCCTCAGTAGTGGCTGCACCGGAACGGCACCTCCTTGGAAATCCACGGCCGCGTGTACTCACACCCTTGCAAG
TAGAGCTTCGTCCAGCCTTTTCGTTTCTTCTTAGCGGGTG