Description :
From Genome Similarity Track
Location :
Scaffold_10:107637- 108798
Transcript NameFunction/comments
Phyci_213047Hypothetical protein
Phyci_2780conserved hypothetical protein

Sequence
1161 bases(100 bases per row)
TGGTCGTGATCGTGATCGCGACAGAGGTCGAGAACGAGATCGTCCTGGTAGTGCTCGGGAACGCGACCGTAATAGTGGCCGCGATAGAGATCGTGACAGT
GCTCGCGGACGTGATCGCGATGCCGGTCGCGATCGAGACCGGGGGCGCCCTCGAGAGCGCGAAGGTCGTGGAGGACGTGGAGCTGGAGGCGATCAGGAGA
AAGAGCGAGGCGGCCGAAACCGGGGAGAGCGAGGTGGGCGCTCGCGGTCCCGGGAGCGTGATTCTCGCAAGCGCAGGGGTCGGGACGAAAGCGCCGGAGG
AAGCCGCGGCCCCGGCGACCAGCGTCACAAGCGGCGGCATTAGACGACAGAAAGACGGCAAGACAGCGATCACAGCATGGCTAGGTAGTGCTTACCACGA
TATCAATCATCTAACAAAACAAAATGCTAAATTGCAGTTACCCTTGGTGAGGTGGTGCGGTACTCAATTGTTGTTGTCTAACAAGCTTTCTATCTGAATC
GAGGCAGGCGCCTAGATCTGCTTGTGCAGCCACAGCTCGGTCTCCAGCTTATCCAGGTCCTGTGCCGTCACCTGTAACGCGATGACTGCATCACCCTGGA
TGGCATCCACAGGCACGAACGTCATGCCCGGCATGCTGTTGACCTTGCCTCGCGCTGTAACAGTCTCGAGGTACACCTTAGCTAGCTCCACCTCGCTTGA
TAAAGCTGATGCCACGTAGAATGTGCGCACGTGAATCACGCGGTCCCAAGGCATCAATGCTTGTACCAGGCTATCTAGCACGCATGTCCAGATTCCTTCT
GCAAGCGCCTTTGCCAATGCTCGAGTGTCTGCATGCATTCCTTCGCTTTCTACTGACGCGGTACACACGATCTGGCAAAGCGCACGCGGGACCATACCGC
TTTGCCAGTCGAAGCGCAGGTTCTTTGAACGATTCGTACGCGTAAGGCTGCGCGGAACCAGGTATTTGAGCGCGATATGGGTGAGCGCCTGAAGTTCCAC
CTCCACGAGAGCATTTCGCGGTAAGCGAGAGAGCTGCACTACCAGCAGCGGTGCCTGCTTTACGAACTCCACGCGGGCTTCGTTCTTGTCGACGTCCTCG
TCGCTCTCATCACTGTCGTCGACAGACTCGAATTCATCCTCCAGCTCGGCGTTAGTCAGAA