Description :
From Genome Similarity Track
Location :
Scaffold_27:107631- 109995
Transcript NameFunction/comments
Physo_115644putative polyprotein

Sequence
2364 bases(100 bases per row)
CAACGTAGGGACGGAGAAGGCAAAGCGATTCCTACAGACCGATTGGGAGTCGTTCAAGAATAATCCGGCGTACCGGGTCATCCTCGGGTACAAGGATAGT
GTGTTTACACCCGAGCTGCCGGACGGATTGCCGATGGAGCGTGATATTGAACACCGTATCGACGTGAAGGACCCTAACATCGCAATGTACCGACAGCAGT
GGAGACTCTCACCCGAGCAGAAGGCCGAGATCGACAAGTGGGTGCGGGAAATGATCGCTAAGGGATTGATTCAGCCGAGTATTAGCCCCATGCAGCTCCG
ACATTCTGCGTTCGTAAGGCTGTGGGATGGTGCATCGTGCACGACTACCGGTATTTTAACAACAACACGATCCGACAGAGCGTACCGATGACGCGTAAGG
AGGATGTTTTCGACAGTATGGCAGGTGCTTACTACTTCTCGTGCATGCTACCAAGTGCGGATGAAGATGGATCACGTCAAGTACACAGCATTCCAAGCAT
CAAGTGGCTTGTACGAGTATCTGGTGTTACCAATGGGAGTTAGCAACGCACCAGCAACGATGCATCGATTGACTTCCTCATTGTTCAAATGTCTCCCACA
CACACATTCATTTTACGATGATATCTACGTGTTCGCGATGTCGAAGGACATCAACGAGCACCTGCGAGCCCTTCGCGACGTGCTGGAGATTTTGAAGAAG
AACAAGCTGTACGTGAAGCTCTCCAAGTGTGTTTTCTGCGCTGAACAGATTCCATGTCTGGGTGATTTTGTCGGTCGGAATGGAGTTCGTATTGATCCTG
ACAAAGTGCAGACTATCCATGACTGGCCTGTACCACGAACCCAAGAGCAGCTTCACAGTTTCCTTGGTTTGACGGGATACGTACAGCGGTTTTGTGAGCG
GTACACCGAGCTTACGGCTCCACTATTCGCGTTGTTGAAGAAGAAGAATCATCGAAATTCGAAGATCACTCTCAACGCGGTGCAGCTGCAGAATTTCAAG
GAGTTGAAACGCCGGTTGTCTGACGCTCCGGTTCTGCACTTACCTGATTTCACACAGCAGATGCATCTGCGAACGGACGCAAGTCAGTATGCTGTTGGCG
GCGTGCTCTTTCAAGTCATTGAAGTCGAGCGCTCGATCGCGTACACGAACAGGAAGATGAACTCAGCCGAGCTCAAGTACCCAACGCAACAGCAGGAGCT
ACTCGCGATTGTCAATGCATTAGCTGCGTTTCGGATTTACTGTTTGGATCGACCGGTCATGGTAGAGACGGATCACAAGTCACTTGAAGGTATTTTCCAG
CAGAAGATGGCGAACCGACGCCTTGCGCGTTGGTACGATATTCTGGCCGACTACCAACCCGTGTTTGCTTACCTACCGGGTGCTTAGAACGGAATCGCTG
ACGCTTTGAGCCGACGCCCTGACCTCAAACCTGAGACGAAGGATTTCCACGATTTGCTCGTCCCCGGCTTCAACGAGACCAGCTACCAGTTGCGTGTTAC
GGAGATCAAGCCTAGCAACGATCTGATCAAAACAATATGCGCTGGTTACGCAAAGGATAAGATCATCGATGATATTCTGCGCGCGATCAAATGACGTGGG
ACAACGTCGGTAACACGAGGGATATCGGAGAAGCAGTACAAGCCGTACTTCGAGGAGAAGAATCTGATATGGTATCAAAGCTCTACAGACGAGCAACCTC
GTATCGTGGTCCCGAACATTGTGGCACTCAAACATCGCATCATCGCTGAAGTACACGATACCAATTACGGTGAGCATCCCGGCGCAGATCGCACATACCT
GAAACTTCGCTCGGATTGGTATCGGTCACGCATGGCACGGACGATCAAGAAGTACATTGCAGACTGTGAGGATTGTCGGCGCAACAAACCGCGGTTAACG
AAGCCACCTGGGCTTCTGGAACCATTACAAATTCCGGACGAAAGATGACGATCGATTTCGATGGACTTCATCACAGACCTACCGGAAACCAAGCGAGGAC
ATAACTCAATTTGGGTGGTTGTTGACCGTCTCACGAAGCGAGCACACTTCATTGCGACGACGAAGAAAGTTGCAGCTCAACAGGTCGCGACGCTGTTCAT
CGACAACATTTGGAAGTTACACGGCATGCCTCAAGACATCGTGTCAGATCTCGACACGAAGTTTGTCTCTGGGTTTTGGAGTCAAGGGTTCGAGAACGTT
GGGACCAAGCTGAAGATGACTGTTGCGTACCGTGCGCAAGGCGACGGGCAGACCGAGCGCACCAACCGCACACTCGAAGAGTACCTGCGCTGCTTCGTGT
CTCCGCGTCAAGACGATTGGGATGTCCATCTCGCGAACGCTGAGTTTGCCATCAACTCCGCGGT