Description :
From Genome Similarity Track
Location :
Scaffold_10:1076234- 1078368
Transcript NameFunction/comments
Physo_527380Os09g0415000

Sequence
2134 bases(100 bases per row)
TCCCCACGCAGCCCCAACATTCTGTGTCCGGAAACCAGTTGGCTGGAGAATTGTTCACGACTACCGGTACTTGAATTCGAACACCGTGCGTCAAAGTATC
CCGATGACGAGGAAGGAAGACATCCTTGACACCATGTCCGGTGCGTACTGGTTCTCCACGATGGACCTGATGTCCGCGTACTACCAAGTGCGCATGCGGG
AAGAAGACATCAAGTTTACCGCATTCCAAGCGCCGAACGGTCTCTGGGAGTATCTCGTTCTTCCAATGGGAGTTTGCAACGCGCCAGCAACGATGCACAG
ATTGACATCGAAGCTCTTTCGAGACTTGAAGAACACGAAGTCGTTCTACGATGACATCTATGTTTTCACCAAGTCACCGAAGATTGAGGACCATCTGGAC
GCACTGCGGAAAACACTTGACATCTTGCGTGATAACAAGTTGTACGTCAAGCTGTCCAAGTGTGTCTTCTGCTCCGACGAGATGCCGTGTCTCGGAGATT
TCGTTGGGCGAAATGGAGTTCGGATGGATCCAGACAAGGTGCAGACCATCGAGGACTGGCCTGTACCACGGACGCAAGAAGAGCTTCACAGCTTCCTTGG
CTTGACAGGTTACGTCCAGCGATTCTGTCCAGAGTACGCATCTCTGACAGCCTCCATGTTTGCGCTCTTGAAGAAGAAGAACAAGCGGAACGCCAAGATT
CATCTCAGCGACGAGCAGCTGAAGAACTTCATGGAGTTCAAGCGGCGACTGTGCAACCCGCCAGTATTGCACTTGCCGGATTTCAGCAGCCCCATGCATC
TGCGTACCGACGCAAGCAAGTTTGCTGTCGGTGGAGTCCTTTTTCAAGTGGTGGACGGAGTTGAGCGCCCGATAGCGTACACAAGCCGGAAGATGAAGTC
GGCGGAGCTCAACTATCCGACTCAGCAGCAGGAACTACTAGCGATCGTTCATGCGCTGGCAGCGTTTCGGATCTACTGCCTGGACAAACCACCCATCGTC
GAGACGGATCACAAAAGTCTCGAAGGACTGTTCACCCAGAAGATGGCCAACCGACGACTCGCTCGCTGGTACGACATCCTTGCGGAATACCAGCCGACGT
TCTCGTACCTTCCCGGTGCGAAGAATGGCATCGCAGACGCGTTAAGTCGAAGGTTAGACTTACAACCGGAGACGAAGTTCTTCCACGACTTACGGGTGAC
CAGCTTCGACAGCACATCCTTCAGCCTCGCGATCAGCGAAGTAACGGGTGACTCGGAGCTGATTACGCGCATCAAGAAAGCGTACAAGAAAGATCGTGAT
GACCAAGCAATCTTGACAGCAATCAAGCGACGCAAATCCGACTCAAAACCAAAGCGCGAACACCAGCAGCACAAGAAATACCGCTGCTACTCCGAAGCGA
ACGGGTTACTGTGGTATCAAACGCCTGCAGATGACGCTCCACGGATTGTCGTGCCCAACGATGTGAAGTTGCGACAGACAATTATCAGCGAGTGTCACGA
CACCAACTGCGGAGGCCATCCCGGTGCGGAACGTACGTACTTGACACTGGCGCGCCATTGGTACTGGTCAAAGATGTTGAAGTCCATCCAGAAGTTTGTC
GCCGACTGCGAGCCTTGTCGGAGGAACAAGCCGCGGTTGACGAAACCTCCTGGATTGCTCGAGCCACTCAGTATTCCAGACGAGCGTTGGAGATCCATCT
CCATGGACTTCATCACTGATCTGCCGCGAACGGAGCGGGGCGTCGACTCTATCTGGGTCGTCGTCGATCGGTTGACCAAGCGGTGTCATTTCGTGCCAAC
CACCAAGAAGGTGAACGCCGAAGGTGTTGCTCGACTCTTCATCGACAACATCTGGAAGTTACACGGCATGCCGACGAATATCGTCTCCGACCGCGACAGG
AAGTTCGTGTCCGCCTTCTGGTAGCATGTCTTCAAGTCCATCGGGACGAAGCTAAGAATGACCGTTGCACATCGCGCTCAAGGTGACGGACAAACGGAGC
GCATGAACCGAACCTTGGAAAAGTATCTTCGGTTGATCGTCGGTCCACTTCAAGATGATTGGGACGTCCATCTCACCAACGCTGAGTTCGCTGTCAACTC
AACTGTCAACTCCAGCACGAAGCTTGCGCCGTTC