Description :
From Genome Similarity Track
Location :
Scaffold_64:107616- 109211
Transcript NameFunction/comments
Sapdi_VS20SDRG_13878hypothetical protein

Sequence
1595 bases(100 bases per row)
AACCAAAGCATCCTTGTGAGCGGCGAGTCGGGCGCGGGTAAGACCGAGACGACCAAGATCATCATGAACTACCTCGCATCGGTCTCGTCGGCGACGACGC
AGAATGGCCACGCTGCCGAGCGAGAGAACGTGCGCAACCGCGTGCTCGAGTCCAACCCGATCCTCGAAGCCTTTGGCAACGCCCGGACCAACCGCAACAA
CAACTCGTCCCGCTTCGGCAAGTTTATTCGCCTCGGCTTTGCCAAGGACGGGACGCTCCTCGGTGCGTCGATCGCCACGTACCTCCTCGAACGCGTCCGG
CTCGTCTCGCAGTCGATCGGCGAGCGCAACTACCACATCTTTTACGAGCTCTTACGTGGCGCGTCGCCCGACGAGCTCGCTGCGCTCAGTCTGACACATG
TCGAGGACTACAAGTACCTCAACCAGACGCAGTGCGTGGACCGCAAGGACGGCGTTGACGACGGCGACCAGTACACCAAGACGCGCCACGCGATGACGAC
GATCGGCATGTCGGACGAGGAGCAGCGCAGTGTGCTCGCGCTGGTGGCCGCCGTCCTGCACCTTGGCAACATAACGTTTGTCCCGCTCGACGGCGAGAAC
GAAGGCTGTCGCATCTCAAACGAGAGTGCACTGGCGTCGGCGAGCTGCCTCCTCGGTGTCGACAAGGCCACGCTGCAGAAGAACTTGTGCAGCCGCGACA
TCCGAGCTGGTGGCGACGCGATCACGGTGCTGCTCTCGCCCGAGAAGGCCGAGGTGACGCGGGACGTCATGGCCAAGACCATTTACTCGCACCTCTTTGA
CTGGCTCGTCGACCGCATCAACGTCTCGATCGGGTACGTTCCGCCGACGGAGGAGCGCTTCATCGGTGTCGTCGACATCTTTGGCTTCGAGATCTTTGCG
ACCAACTCGCTCGAGCAGCTCTGCATCAACTACGCCAACGAGAAGCTCCAGCAGCTCTTCTCGCAGTTTGTCTTTGAGAAGGAGCAGGAGGAGTACGTCA
AGGAGGCGATCCCGTGGACGTTTGTCGAGTACCCCAACAACGACGCGGTCGTCACCATGTTCGAGTCGGTGCGCCCGATGGGCCTCTTTGCGCTCTTGGA
CGAGCAGTGCAAGCTCCCGAACGGCAACGACGTGAGCTTGTTCACCACGTACTTTGACAGCTTTGCGTCGACGCCGCACCTGCATGTCTCCAAGCTGCAG
CGCGGCGTCCAGCTCTTTGTCGTTGCGCACTACGCCGGCGCCGTGCCGTACGCCGCCGCGGGCTTCTGCGAGAAGAACAAGGACCACGCGCACACCGAGG
CGGTCGGGTACCTCGCGTCGTCCTCGACGCCGCTGCTCCAGACGCTCTTCACGGCCTCCGCCGGCTCGAGTGCTGTGACCAAGCAGCCGTCGACGGTCGT
CGCCAAGTTCAAGTCGCAGCTCGCGAGCTTGCTCTCGCTATTGCATTTGACCGCGCCCCACTTTATCCGGTGCATCAAGCCCAATGACGCGGCGTCGTCG
ACCGACTTTACCGTCGACCGCGTCGCCGAGCAGCTCCGGTGCTCCGGTGTCCTCGAAGCCGCCAAGATCTCGCGCACGGGGTACCCTATCCGCTT