Description :
From Genome Similarity Track
Location :
Scaffold_64:107616- 108900
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_10776peptidase-like protein

Sequence
1284 bases(100 bases per row)
CACGCGGTCGTTGGTGTTGCTATAGTACTGCTGCCGGATCGTGAGCGCTTCGCGCAGGTATGTCTCGGCCGCTGCATATTGCCCCTACATCGTCCATACG
AGTGGCGGTCTAGACAAAACGCGTTGGGTTGTACCTGGTTGTACTTGTGGTTGCCAAGGTTGTTGAGCGTCGCCGCGGTCTCGGGGTTCTTATTGCCGAG
CTTCTTGCGCCGAATGTCAAGCGCCTGTAGGTACAGCTGCTCAATCTTGGCGTCAATCTCCGACATCTTTTGCGGCGACGGTTTGCGCCTACGCCAGCTT
TGATGACCGCATCGAGGTAGCGAGAACGTACGCCTTGGGCAACTTGTCGGTGATGTGCACGAGGAAGAGCGCCATGTTGTTGAGGCTCCGTGCGACGAGC
GGGTGGTCCTTTCCGAGGTGCGCCTCGTAGATCGAGAGGCTCTTTTCATACAGTTCTTGGATCTCATCGTTGGTCTTGAGAAGCACACCGCCGTAGCCCA
AGCCCATCGATGAACTATCGCCCTCGTCCTTGAGCATCGTGAGCGCCGACTTGTAAAAGTTGCCAAGGTTGTTCAAGCTTGTCGCATAGTCGGGGTGCAC
GGGCCCAAGGACGCGCTCGCGGATCTCCTTGGCCTGCAGCAGTAGCGCCTCGGCCTTTCGGAACTTCCACGCATTCACGGGGCTAAAGCCGCGGCGCATT
GAGAGCACAATCCCGAGGTAATTGAGCGCCTCCGCGACGTGCGAGTGGTCGGTCCGGTGCAGGACCTCTTGCTGGATGCGCAGCGACTCGCGGTACATGT
GCTCTGCGTTGGCGTCTTCGTTGACGTCATAGTGCGCGTACCCCATCTCCATGACCATGAGCACCTCGAGCGCAAGGAGCTCCATCACGCCCGGACACGC
GCAGGGCGGGGCAGCCTCCGGTGCTTGGCTTGGCTCATAGCTCGACGGCATATCGCTCGTGTCGAGGATCGTCGAGTTGTTCTCAATATGGCCGCACTTG
CAGTTGAGGACACGCGCGGTCTTGGAGAATTGGATGCTTGTCGCAAACAAGCGCAGGCGGAAGCGCGGGTCCATGCGGGCGCGAAAGATGAAGCGGCCGC
GCACCATGAGGTTGCTATGGAGTAGCACGTCGATGAAGGGCGCGTAGCCGCCATCGTCGTCCTCGCAGCCGGTCGCCATGCGCTCGCGCGCCGTCTCTTC
GCTGTGCTTGGAGAGCTGGTGGGCGATCCGGAGCGCCGACTCGATGTTCGAGCGCTCCGAGTCAAAGAGCGTCAGCGACCCTTC