Description :
From Genome Similarity Track
Location :
Scaffold_2973:1076- 2470
Transcript NameFunction/comments
Phyta_totarag14978hypothetical protein

Sequence
1394 bases(100 bases per row)
agaagacgaacaagTATACTTCAAGGAAGGAGGCGAGCTGTTCGAGGAAGCCGTCGAAGGTCAGATGGTGGTGTTATCCGAGGTTACGGCGATGACCGAG
GAGGTCAAGATTGAAGGTATTCAGGTTGGTGATCTCCACGACAACACGCCGGAAGAGATCGACCGATTGCGGCGAATCATATGGCGTCGTCGGCATCTCC
TGATTGGGAAATGCAACGCTTTACCACCAGCTGTGAAAAGGACGATATGCGACATAGGCGTGGGAGGGGCTAAGCCCATCTCCCAGCGGGAGCGAAAAGT
CGACCCGCAGTTCCGCGAAAATTGTTCCAGCTGATCAAGGGCTATTGTCCGCGGAGATCATCCGACACTCAACTTTACCCTGGGCTTCGCCGATCGTGAT
CATCGTCAAGCAAATGGAGTTGACATCAATCAGGCTATGCATTGAATGCCAGTTGATCACAGGCTGACACGATTGGCATGCCGCTGATCAACGACGATCT
CGACAAGATGCTTTGGTACTGCTCGTTGGACATGACCAGTGGTTTGTGGGTCATGTCTATGACGACCGGGCTCGCGCGATCCCCCCCCCATGCATTACCC
CGTTTCGCCTGTTTGAGTGGAGCCTAATGCCATTCGGATTGCAGAACGCGCCGCAAATCTACCAGTGACTGTTGGATAACGCTCTGTACGGCTTTTTCAA
GATCACTAATGATCAAGGTCGCCCCAGTCAGATGTTCAAGGAAGGAGAACCAGACACGGAGAAGGAGTCATCTGTCTTGGGTCGTCGATCTTATTTCGAC
GACATCCTGGTGGCGACCTACACGTGGGACACGTTGTGCGACAAGATGGACAAGTTGCTTGACGCGTGCGACCAGTGGAATTTGCCGTTCAGCGTCGCCA
TGAGCTTCTGAGGCCTACAAAAGGTGGAGTATCTCGGACATCAAGTATCGATCGAGGGTTTGGAAGCTCACTCGAAGGACTAGTCATCGCTAGTTGATCT
GCTGTTCCCCACGACATTAAGGTCGATGCAATCTTTCTTGGGTAGACTCAACAATTACAGTCTCTTCATTGAAGATCTGGTAATCTACATTTCGGTCTTA
TATGAGCTCCGGGAAGCCTATTTTTATGAGATCGCGAAGAAATCAAAGTGTGATCTGGAGACATCAAGGCGCGGTCTGGAAATCAAAGATGACAATCGAC
CTATAGAAGCCAGGAAATGGGACTGGGCGACGGTCGCATTTGCAACATTGAAAAACAAGAACGCGACAGCACCCATCCTGCAGCACTTCGACCCAGATCA
AAAACCCGTGGTCGTAGCCTACGCGAGTAAGTGGACGATCCCTGCTAATTTGATGTAGGAGtgagacgaggcgggtgaacaccttttgaCCGTC