Description :
From Genome Similarity Track
Location :
contig_182:1076- 2252
Transcript NameFunction/comments
g14087.t1hypothetical protein

Sequence
1176 bases(100 bases per row)
AATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCC
AACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCTCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACG
CATGTTGCGCGTGCAGACTGCCACCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGT
TGCGAACGCAATCGCCGACGGAACAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGC
CACACCGCACGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAACCTCTCCTCCGTGGCTTGTCGAGGTCGACATTGCCATAA
CGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCAAGGAGTTGGGCGTACGGACGCCGACTCACAGA
CCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGAT
CTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCG
TCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGTAATTGCGCTCGCAATGCAAGA
ATGTGAACGCCCCGCGGGTGATGCCACGACCGGTGGTAAGGCCGTCGGGGAGGTCCCGAACCAATGGATCTCTCGAGTGCGGCCGCTGCTGGTTTCCAGC
AGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCTCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCG
TGGCGATACTGGGTATCGCCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATG