Description :
From Genome Similarity Track
Location :
Scaffold_33:107579- 109808
Sequence
2229 bases(100 bases per row)
ATGGAGTAAAGCCCGCAGAGGCATGTACAGAGTTGTTAAGAGAAAAATCAACAACTGAAGCATAGAGCTCCAACGTTTAGGCGCAATTACACATATACTA
CATAGGATATGTTCGACAGCGAGATTAACGCGCTCTGTTTGACCATCGTCTTGTGGGTGATCGGACGTGAACATATCCAAACGAGTGCCAAGCACCTGGA
AGGTGGAATGTCAAAACTTACTCGTGAAACGAGGGTCATGGCCAAAGCCGATGGCCACAGAAAAACCACGAGGGAGACTTACCCGATCGATAAAAGCTGT
GTTTTACCTTCACCATTAATTGAGTTTGGCACATCCGCTAAGTTAGCCATCTTGCTCAAGCGGCCAACAAAGACCACAATATTAGTGTTGCCATCTGAAT
CTTTCTGAAGGCCAAACAAAAACTCCATACAGATGGATTCCTAACACCCCTTGAGTACAGGGAGTCTTGCCAGTGGCGCAGCTGCATGTGCGGAGGGTTT
AATCCGTTGACACGTTCCGTACATGCGAACATAGGTACTAACCCACTTATAGATCTTGGGCCACTAATAACTTCGACTCACCAAGTAATAGTTTTTTTAC
GACCAACATGACCGCTCACCGTAGTATCACGTGCATCATAAACGATCAGATACTTTTTTTACTCCTTATGTGTAACGGCTATACGAGGGTGTCCTCAGTA
CCTGTGCGATATCTCAACAGACCTTGATCGATACTATATCAATAGATCCACTCACTCAATCGTTGAGACACCTAAAGTTTAAGTATCGAAGCTCCTCGCT
CGAAAATGCACATAGCAAATATATATTAGGATCACCACAAGCATAAGACGCACGAATAAAGTTGGAAATGGACGACGACAATGTTGTCGCATGATCAATT
TTATAATCAGGTTCACGTGATAACGCATCCGCCAAGCGTTCAGTTTCCCGGTTTGTATTTAACCTCGAAGTTTTATTCCCCAAAGAATGAAAACCAACGA
GTCATTCTATGTTAGAAGTGAGGTGACTGAGTGGCGGAAAGTATTGACGCATGATCGGTTACTGACACAAACGGCTTAGAGCCAAACAGAAGTACTCTGA
ATTCAGCTATAGCATACTTCATGACAAGTGACTCATTGTAACTAACTGGATAGTTCTTTTCAGAAGCTATTAGCTGGCAAGACTCAATATCGAGACACGC
CCACGCCCCTCAGCATCGGTGTGTAAAAGATTACTGCCAATTGCTAAACCAGACGACGCTAAAAGATTTCTTTGGATCGTGCGGGGCCAAAATCGGGGCA
TGAAGGAGACTCTACAGCAATAAAAGTATGCTCTCCAATGCTACTCCAGGATCAATCCATATCATTTTATCACTTGATTGGACGATGGACTTGCCATATC
AGGCTAATTCGCGCTATACTTTTTCAATTAGTATACAAGACTGAGCCACTTGCGCAAGTCCTTCTATTTCCTAGGAGCCAGCCAATCAACTTTGGCCTTA
ACTTTTACAGGGTCTGCTCTCAGCCCACTCTTCCCTATGAATCACCCCAGAAAGGTAATCTCCTCTGTACGAAAGATACACTTAAAAGCATTAGAATATA
GATTATGGGTGCGCATGCACTCGAGCACTGCTCGCAAATGTTTGATGTGCTTTTTCACATAGGTACTCCATGCCCTGCTCGACTATTCGCAAACATATCA
TCAAAAGAGTAAGTCTCTGCGTAACCTTGGTAAGGACGGAACCGCTCCGTTACAAGACGATTTAACGTACCCGGGGCATTAAATAACCCATGTGGCTTCA
CCAGCCATTTCCGAAGCATTTCACTCGGATTACTAACTGCTGTGCGCGGAATATTGCTCTCCCGTATGAGCAATTGGTATTAACCATCGCCTAGGTCGAG
TACACTGCACATGGTGCAACCAACCATGATGTTTTAAAGAATATTATTCCTAGGAATTGGTGTTTGCGCTTGGATAACAGCAGGATAGAGCTTATAATAA
GCATGAACAATGCACCCCTAGCCATGAGGTTTTTTCACACGAAAGTTAGGCGTATAGTGTGGAGATTTACTCCTGCGCACCATAAATGCCGCGTCCTTTG
CACGAAATAACTCATCGATCACGTCACACTGTTAGTTTGGCAAAGTCCGTTGCCGCGTAACGCAATAGTTGTTCCCGGAACCATATAAATCTCATGATGT
ACACCACTGTCGAGAAGTAAGAACGGAGG