Description :
From Genome Similarity Track
Location :
Scaffold_199:107573- 109895
Sequence
2322 bases(100 bases per row)
GCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTAA
ATAGCCGGTAGTCAATCCACAGACTTATATCCACACCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGTCGAGAAACTGATGATCTT
GGCTTGCAGCAGGACCTTAATCAGATCCGATAATCTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCG
ATGTCGCATTTGACTCCGCGGACAGCGGGCGGTAATGCATTACCTTTACCAATCAGCAGATGTCGGGTTTCCCTGATCTTCTGACGTAACCGATCCACTT
CCGCGGGTTCGTTTGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTTAGTGGTACCTCCGGGATCACCGCCAGGCCTTCTCCGAG
ATCCTCGGCGGGGCGTGTAGACCCCGCCTTCATGGTAACAGACTTGTTCATCTTCCGTCTTCATCGGATTCACCATTGGATCCAAGCACCGCGACCCTAT
TTCACCTGTCAGTCCTTCTGTCTTCGTGGGATCAGGTACCCCAGTACCTGGAAAGCCACCAGTTGGATCGACTTGATCATCTAGCGAGTTTAAACACGAC
GGTTCTTGTTTGACTAGTGTTGCCATTCTCGATAAGGATCCAGGCACTTTGTCCCATGAAAAGCTAGGATCCACTCGGGGGTCAGCGGGATCTGGCGACT
CGGCTTCAACCCTCTACGATCCTTCATTCACCGACCCTGAGTTATCTAGGGGCTTGCTCCGGGGATCTTCCCCTGTCTTGGATCCCACCTGTATCGCTTG
GATCTCAATCCGACGACCTCTCTGCAGGATCTTTCGTGGAGTTGGGTATGAAGGCCGATCCACCAAGTGGCCAGTTAGCTCCGCCAGGAGCTCCCCCTCC
CCGAGAGATTCGATCTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTCTGTAACGACGTGATCCCACTGACACATATCCAGGTCGCCTAGGGATGC
CGTCCTTCGCCAACCATCGCCCGATCTCCTCATAATGGTTCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCC
CTGATCACGGAAGGCACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTCAACCGATCTGGCAGTTCCCAGGTTTCTCCGGGCT
CGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCATACAACGGTCGTCGTCCGCTGAGCTGGATCCGCATTTTGTCAGGGAAACAAAG
TGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCAAAC
CAGTACACCAAACAACCTGCCAGCGTGATATTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACATAATCTTGGATCCGACTCC
CATCCACTTGGCACCCAACCTTTATGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCT
TGCCCCCTACCTTGGCCTGTCTGAACCACTTACCTGGGGCATGGTACTTTCCAGTATCCACGGGACCCCCCTGTCAGCAGATCCACGGATCCAACATCTT
CCGATCCACGGGATCCAGTGACCTGACAAACCTTGGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTCTCGTTTCTCCCA
ATAACCGCGCGCTTCTCCCCGTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTAGCGCAAACTAGAAATCTTGGCAACGGAC
ACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGATCCTGCTACCTGGATCTAGCGATGTCTAGTTCACAAATGCATAAATGCAATACCTAGAGC
GCTCAGCTCGTACCGGATTCAAACTCGGCGAGTGTCCTAGTTTAACATCTTCTCTGCCACTTCTGGCAACATCCCTCTGAGCTTGGCTGGATCAAACCAC
TGGCGGATCTGGTTGTAGTATACCTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACAACCGCGACACACGTAGAAGCAATGATCTCCGGGATGAC
CCTTCTTGCCAAACTTCTCACA