Description :
From Genome Similarity Track
Location :
Scaffold_692:10756- 13026
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_692-fgenesh-gene-0.2Glycosyl transferase group 1
Pytve_DAOMBR484maker-pve_contig_692-snap-gene-0.5ATP-binding Cassette (ABC) Superfamily

Sequence
2270 bases(100 bases per row)
CGAGTCGCTGCGCCAGCGGGAGCGACGGCGAGNNNNNNNNNNNNNNNNNNNNNNGCTTGTCGCTGGCTGGACGACCCAGCGGTGGCAGCTTGTCGAGCGG
ACGTCTGTCGAACATCCTGCCGGTCGGTGGTGACGGACGGTGGGGGGCGGATTGGAGACTGTCCGCTTTGCACGAGGGGATCCATTGGGAGGCCGTGAAT
CAGGAGCGGGGGTCAGCTTCAGGTTCCATTCTCGAGAGACATGCGCATCACCGCAGAAATGGATGCATGACGCACGGTGAAGCGCGGTGATTGGCTGGAG
ATGGAGCCATGTTGAGCTCGGATTCGCTGAAAATGGCGGAGGTCCCACTTGATGAATTATTCGAGCCGAGTGGTTGGATTCTTGGATGGGTCGGCCACCC
AGTTGAGCAGCATGAGTGTCCATGATGGCAGGGCTCTCTCGAGGCTTGGTCGGACACACGGAAGCGCGTCCCGGAGCGCAGTCGAGGCGGCGGTGCCGTT
CGGTGCGGCCAGATATGAACGGACGCATGAAATGGAGCTGTGGCTTAGGCTAACGATGGCAACTGAGCGGCAACACCAATCGCGTCGAGTGTCCCTCATG
GATCGAGTTGAATGCTTCCTCAACGCCTGCCTAGTGCGGATGGTTGACCGCACCCAACGTCGTGAGGGAGGCTCGCGACATGCGCTCGGTTGCAGCCGCG
AGCGAGTCGCTCTCCCTGGCGCACCTGGAGAGCCCTGGTTCGATCATCACAGCGCTCTTGCAGGACCAACACCTTCGAGTGCGGTACTGCACGAAGTGCT
CAACTAGCAAAGTCAAGCACCGGCAATTCGCGGCAAGCGCGAGCAGCTCGCGGCACTGAGTCTGTCGACACCACCAATGCTTGCACATGTACCATCCTTC
ATGCTGTAGAACCTCTATAAACGAGTGAATCTCCCCGAATACAAGGATCGAAACCATGATTAAGACCGTGTCAACCTTCTATATCAAATAACTCAGTTAA
ACAAATACCTGTATCCGTCTCTTGTGCCACCTGACCAAGCGTGCTTGGCCAAACACGCCGATGTCGTCGCCTCATGCGATCCGCGCGATGCGTTACCCCG
CTCCAGGCAGCACGCTGCTGTCCACACGCGCAGGAATGACCGTCGTCTCGAAGCGTGTGTGTGGATGCGCTGCGTCCCGCAAGCCAGCGAGCCAGCGTCC
CTGCCCGACGAACAGCGCGAACAGAGCCCCGCCGACTGACTAAAAAGGTTCAACCTCTGCGACCACACGCCGCCTCCGCCGATCGATCCGTCAATCCTCG
CCACCGCCATCGCCATCGCTGGTCGCCACCGCCGCCTCCCCGTCACGTTGAAGCTCCTCGGAGGCGCGTGCCCCGATCGCCAGATGTGTGCACCTCGCGA
AGTCAAGTCACTCTGCGTCGGCCTTTCCGTGCAAGCGCCTTTCTCACTGGTTCAAGGCACGCGCGGGGTCTCGGCTTCCCGCGTAAGTCGCCGCTGCTTT
TCATCAGTCTGGCACGAGGCAGACGCGGCGGTGCTGGCTGGAGGAGGATCCGTGGCAGCCCCGCTCCTCCGCTCCTCTCCATGAGACCCTCACCATTGGA
GCTGTCATCCATCACTCGGCGAGTGTTTCGCGTGCGTGAGTCCCTCGCCGCGCGGCGGTGGCTCACTCTCGGATCTTCCCGCGAACCGCAAAGATGGCGA
GCGACCATGGCGGCGACTACGCCGAGGCCAAGACGCCGCGCGCCGAGATCAAGATCGCGCCGCCGACCGAGTCCGAGACCGACAAGGCCGCGTCGGACTC
GACTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGTTCCAGCTCTACCGGTTCGGCACGGCGTGGGACAAGCT
GTGCGTGCTGCTCGGCGTGCTGTGCGCGGCCGCGCAGGGCACGCTGTTCCCGTTCATGGCGCTCGTGTTCGGCGACGCCATCCGGGGCTTCACGCGCTCG
GACGGCAGCGTGGACCGCGACGTGGTGGACCGCGCGGCGCTCAACTACTTCCTCATCGCGCTCGGGCTCTTCCTCACCGAGTTCGGCTCGTACGTGCTCT
TCTCCATCACGGCCGAGCGGCAGATGAAGGCTCTGCGTGAGGCCGCGCTGCGCCACATGCTGCGCATGGACGTGGCCTGGTACGACCAGCGCGAGGTGCT
GCAGCTCTCGAGCCGCCTGACGGGCGACACGGTCAAGATCAAGGACGGCATGGGCTACAAGCTCGGCGAC